Incidental Mutation 'R8929:Cndp2'
ID 679774
Institutional Source Beutler Lab
Gene Symbol Cndp2
Ensembl Gene ENSMUSG00000024644
Gene Name CNDP dipeptidase 2 (metallopeptidase M20 family)
Synonyms Pep1, Dip-2, 0610010E05Rik, Cn2, Pep-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8929 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 84667470-84685633 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84675173 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 154 (I154T)
Ref Sequence ENSEMBL: ENSMUSP00000025546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025546] [ENSMUST00000168419]
AlphaFold Q9D1A2
PDB Structure Crystal structure of mouse carnosinase CN2 complexed with MN and bestatin [X-RAY DIFFRACTION]
Crystal structure of mouse carnosinase CN2 complexed with ZN and bestatin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025546
AA Change: I154T

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025546
Gene: ENSMUSG00000024644
AA Change: I154T

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.8e-35 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168419
AA Change: I154T

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128696
Gene: ENSMUSG00000024644
AA Change: I154T

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.2e-33 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 A G 2: 180,172,937 K99E unknown Het
Agxt2 C A 15: 10,393,744 L375I probably benign Het
Akap13 T C 7: 75,609,004 S459P probably benign Het
Arfgef3 T A 10: 18,603,455 T1471S probably damaging Het
Atxn2l C G 7: 126,493,756 probably benign Het
Azi2 C A 9: 118,049,976 T141K probably damaging Het
B4galt6 A G 18: 20,688,365 S369P possibly damaging Het
BC051019 C T 7: 109,716,026 E341K probably damaging Het
Bdh1 G A 16: 31,456,894 D278N probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cdipt T G 7: 126,979,653 D205E probably damaging Het
Clec4b1 G T 6: 123,069,769 probably null Het
Clip4 T C 17: 71,831,208 L467S probably damaging Het
Cyp2j5 T C 4: 96,658,740 N179S possibly damaging Het
Dpf1 A T 7: 29,309,749 I100F probably benign Het
Dppa5a A G 9: 78,367,883 S46P probably benign Het
Epyc A G 10: 97,675,745 D200G probably benign Het
Ern2 C T 7: 122,170,140 A888T probably benign Het
Fndc3b C T 3: 27,542,104 S112N probably damaging Het
Fras1 T C 5: 96,769,507 V3462A probably damaging Het
Fstl5 T C 3: 76,707,831 I733T probably damaging Het
Gdf3 C T 6: 122,609,797 R57Q Het
Grwd1 A T 7: 45,830,632 D50E probably damaging Het
Hgf G T 5: 16,593,990 D339Y probably benign Het
Kat7 T C 11: 95,306,156 D19G probably damaging Het
Lefty1 A G 1: 180,937,725 E286G probably damaging Het
Lrriq3 T C 3: 155,188,182 F507L probably damaging Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Metap1 T C 3: 138,468,882 K247E probably benign Het
Muc4 T G 16: 32,753,994 I1290S probably benign Het
Muc4 A T 16: 32,754,017 T1298S possibly damaging Het
Nars G T 18: 64,511,824 H82Q probably benign Het
Ncapg2 A T 12: 116,452,363 E1121V probably damaging Het
Nebl C A 2: 17,393,180 E481* probably null Het
Pdap1 T C 5: 145,132,862 E111G probably damaging Het
Pds5b T C 5: 150,719,914 F67S probably damaging Het
Pole T C 5: 110,297,788 F510S probably damaging Het
Ptpn21 A T 12: 98,689,137 Y524N probably damaging Het
Ptpn4 A T 1: 119,667,548 M887K probably damaging Het
Sec24b T C 3: 130,009,858 D414G possibly damaging Het
Sema5b C A 16: 35,647,367 probably benign Het
Slain1 A T 14: 103,685,728 T252S probably damaging Het
Slc36a3 A G 11: 55,137,311 F164S probably damaging Het
Slc39a7 T C 17: 34,030,990 H90R unknown Het
Slc44a4 A T 17: 34,917,532 D58V probably damaging Het
Slc5a4a A G 10: 76,170,783 T340A probably benign Het
Sod2 C A 17: 13,015,087 N195K probably damaging Het
Spg20 T C 3: 55,128,558 S572P possibly damaging Het
Sytl2 C T 7: 90,375,602 A266V probably benign Het
Tbx15 T A 3: 99,314,903 D227E probably damaging Het
Tfap2a A G 13: 40,728,832 V26A probably benign Het
Trank1 T A 9: 111,378,935 F1749L possibly damaging Het
Trpc6 A G 9: 8,643,410 probably benign Het
Ttn A T 2: 76,876,580 I9089N unknown Het
Unc13a T C 8: 71,651,191 T866A probably benign Het
Vmn1r212 T A 13: 22,883,324 S280C possibly damaging Het
Vmn2r82 A G 10: 79,396,707 T847A probably benign Het
Zcchc6 A G 13: 59,800,128 V793A probably benign Het
Zer1 A G 2: 30,110,869 L180P probably damaging Het
Zfp445 T G 9: 122,853,667 Y403S probably benign Het
Other mutations in Cndp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Cndp2 APN 18 84677376 missense probably damaging 1.00
IGL01143:Cndp2 APN 18 84677317 critical splice donor site probably null
IGL01310:Cndp2 APN 18 84670877 missense possibly damaging 0.95
IGL01408:Cndp2 APN 18 84670911 missense probably benign
IGL01520:Cndp2 APN 18 84668607 missense probably benign 0.03
IGL02095:Cndp2 APN 18 84681032 missense possibly damaging 0.67
R1108:Cndp2 UTSW 18 84675060 missense probably damaging 1.00
R1264:Cndp2 UTSW 18 84678791 missense possibly damaging 0.88
R1466:Cndp2 UTSW 18 84677315 splice site probably benign
R1584:Cndp2 UTSW 18 84677315 splice site probably benign
R2363:Cndp2 UTSW 18 84668569 missense probably damaging 0.96
R2383:Cndp2 UTSW 18 84675090 missense possibly damaging 0.82
R3153:Cndp2 UTSW 18 84668597 missense probably benign 0.02
R4590:Cndp2 UTSW 18 84669808 missense probably damaging 1.00
R4788:Cndp2 UTSW 18 84675164 missense probably damaging 1.00
R5033:Cndp2 UTSW 18 84670829 missense possibly damaging 0.94
R5154:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R5178:Cndp2 UTSW 18 84675028 missense probably benign 0.00
R5326:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5542:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5556:Cndp2 UTSW 18 84672124 missense probably benign 0.38
R5722:Cndp2 UTSW 18 84668078 nonsense probably null
R6431:Cndp2 UTSW 18 84675078 nonsense probably null
R6682:Cndp2 UTSW 18 84677330 missense probably benign 0.00
R7036:Cndp2 UTSW 18 84669945 missense possibly damaging 0.94
R7728:Cndp2 UTSW 18 84672077 missense probably benign 0.00
R7806:Cndp2 UTSW 18 84670820 missense probably benign
R8018:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R8949:Cndp2 UTSW 18 84675005 missense probably damaging 1.00
R9127:Cndp2 UTSW 18 84680996 missense probably benign 0.01
R9455:Cndp2 UTSW 18 84672121 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGCCGTACGTGATACAC -3'
(R):5'- CAGGCTAAGATTCATTGCCCTTTTC -3'

Sequencing Primer
(F):5'- GATACACGGCTTATTCTTCCCCAG -3'
(R):5'- ATTGGCTCACTCTGTAAGCGAC -3'
Posted On 2021-08-02