Incidental Mutation 'R8929:Arfgef3'
ID 679753
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8929 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 18581839-18743949 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18603455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1471 (T1471S)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect possibly damaging
Transcript: ENSMUST00000019999
AA Change: T1471S

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: T1471S

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: T1471S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 A G 2: 180,172,937 K99E unknown Het
Agxt2 C A 15: 10,393,744 L375I probably benign Het
Akap13 T C 7: 75,609,004 S459P probably benign Het
Atxn2l C G 7: 126,493,756 probably benign Het
Azi2 C A 9: 118,049,976 T141K probably damaging Het
B4galt6 A G 18: 20,688,365 S369P possibly damaging Het
BC051019 C T 7: 109,716,026 E341K probably damaging Het
Bdh1 G A 16: 31,456,894 D278N probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cdipt T G 7: 126,979,653 D205E probably damaging Het
Clec4b1 G T 6: 123,069,769 probably null Het
Clip4 T C 17: 71,831,208 L467S probably damaging Het
Cndp2 A G 18: 84,675,173 I154T probably benign Het
Cyp2j5 T C 4: 96,658,740 N179S possibly damaging Het
Dpf1 A T 7: 29,309,749 I100F probably benign Het
Dppa5a A G 9: 78,367,883 S46P probably benign Het
Epyc A G 10: 97,675,745 D200G probably benign Het
Ern2 C T 7: 122,170,140 A888T probably benign Het
Fndc3b C T 3: 27,542,104 S112N probably damaging Het
Fras1 T C 5: 96,769,507 V3462A probably damaging Het
Fstl5 T C 3: 76,707,831 I733T probably damaging Het
Gdf3 C T 6: 122,609,797 R57Q Het
Grwd1 A T 7: 45,830,632 D50E probably damaging Het
Hgf G T 5: 16,593,990 D339Y probably benign Het
Kat7 T C 11: 95,306,156 D19G probably damaging Het
Lefty1 A G 1: 180,937,725 E286G probably damaging Het
Lrriq3 T C 3: 155,188,182 F507L probably damaging Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Metap1 T C 3: 138,468,882 K247E probably benign Het
Muc4 T G 16: 32,753,994 I1290S probably benign Het
Muc4 A T 16: 32,754,017 T1298S possibly damaging Het
Nars G T 18: 64,511,824 H82Q probably benign Het
Ncapg2 A T 12: 116,452,363 E1121V probably damaging Het
Nebl C A 2: 17,393,180 E481* probably null Het
Pdap1 T C 5: 145,132,862 E111G probably damaging Het
Pds5b T C 5: 150,719,914 F67S probably damaging Het
Pole T C 5: 110,297,788 F510S probably damaging Het
Ptpn21 A T 12: 98,689,137 Y524N probably damaging Het
Ptpn4 A T 1: 119,667,548 M887K probably damaging Het
Sec24b T C 3: 130,009,858 D414G possibly damaging Het
Sema5b C A 16: 35,647,367 probably benign Het
Slain1 A T 14: 103,685,728 T252S probably damaging Het
Slc36a3 A G 11: 55,137,311 F164S probably damaging Het
Slc39a7 T C 17: 34,030,990 H90R unknown Het
Slc44a4 A T 17: 34,917,532 D58V probably damaging Het
Slc5a4a A G 10: 76,170,783 T340A probably benign Het
Sod2 C A 17: 13,015,087 N195K probably damaging Het
Spg20 T C 3: 55,128,558 S572P possibly damaging Het
Sytl2 C T 7: 90,375,602 A266V probably benign Het
Tbx15 T A 3: 99,314,903 D227E probably damaging Het
Tfap2a A G 13: 40,728,832 V26A probably benign Het
Trank1 T A 9: 111,378,935 F1749L possibly damaging Het
Trpc6 A G 9: 8,643,410 probably benign Het
Ttn A T 2: 76,876,580 I9089N unknown Het
Unc13a T C 8: 71,651,191 T866A probably benign Het
Vmn1r212 T A 13: 22,883,324 S280C possibly damaging Het
Vmn2r82 A G 10: 79,396,707 T847A probably benign Het
Zcchc6 A G 13: 59,800,128 V793A probably benign Het
Zer1 A G 2: 30,110,869 L180P probably damaging Het
Zfp445 T G 9: 122,853,667 Y403S probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18652631 missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18611203 critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18630076 missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18589729 missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18652532 critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18647051 missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18635705 missense probably benign 0.01
R9001:Arfgef3 UTSW 10 18646728 missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18625151 missense possibly damaging 0.81
R9258:Arfgef3 UTSW 10 18589639 missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18599280 missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18616880 missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18630129 missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18603523 missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18646527 missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18652808 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCATGAAACATCATTGTAGC -3'
(R):5'- GACATCCCAATGCCCTTTGC -3'

Sequencing Primer
(F):5'- ACTGAGCATCTACTGTGAGTGAAAC -3'
(R):5'- CCATTCGTACATGGAATTAGCTCGG -3'
Posted On 2021-08-02