Incidental Mutation 'R9103:Adgra2'
ID 691816
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Name adhesion G protein-coupled receptor A2
Synonyms Tem5, 8430414O08Rik, Gpr124, 9530074E10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9103 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 27085583-27123436 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 27113408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 407 (G407D)
Ref Sequence ENSEMBL: ENSMUSP00000033876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514] [ENSMUST00000179351]
AlphaFold Q91ZV8
Predicted Effect probably damaging
Transcript: ENSMUST00000033876
AA Change: G407D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486
AA Change: G407D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178514
AA Change: G407D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486
AA Change: G407D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179207
Predicted Effect probably benign
Transcript: ENSMUST00000179351
SMART Domains Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
Pfam:GPS 5 49 4.5e-11 PFAM
transmembrane domain 67 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,938 C458* probably null Het
Aox4 G A 1: 58,257,282 G1046E probably damaging Het
Arhgap27 A G 11: 103,360,714 Y63H probably damaging Het
Ascl3 A T 7: 109,727,920 M64K probably benign Het
Cacna2d3 G A 14: 29,347,014 T252I probably damaging Het
Capn7 A G 14: 31,369,775 T710A probably benign Het
Carmil1 A G 13: 24,111,853 C393R probably benign Het
Chd5 A C 4: 152,376,987 E1215A possibly damaging Het
Cntnap1 A G 11: 101,181,268 N449S probably benign Het
Cpz G A 5: 35,517,710 S65L probably benign Het
Cyp2c68 T A 19: 39,739,181 N118I possibly damaging Het
Ddx25 A T 9: 35,546,789 F345I probably benign Het
Dennd2d T C 3: 106,490,368 Y161H Het
E330021D16Rik T A 6: 136,401,013 D273V probably benign Het
Egfl8 C T 17: 34,614,236 D179N probably benign Het
Eif2a A G 3: 58,545,040 N174S Het
Farp1 C T 14: 121,271,692 H643Y possibly damaging Het
Fat1 G T 8: 44,951,813 V534L probably benign Het
Fbxo48 A G 11: 16,953,556 T61A probably benign Het
Fnbp4 A G 2: 90,777,843 T970A probably benign Het
Foxd1 T A 13: 98,355,255 D212E possibly damaging Het
Fstl4 C A 11: 52,773,869 H9N probably benign Het
Fyb A G 15: 6,643,751 D622G possibly damaging Het
Gm4787 T A 12: 81,378,715 H223L probably benign Het
Grin3a A G 4: 49,771,179 V531A probably damaging Het
Gzmb T C 14: 56,261,165 D42G probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hsd17b6 A G 10: 127,998,007 W2R probably damaging Het
Hspa4l T C 3: 40,760,917 probably null Het
Igtp A G 11: 58,206,900 E299G Het
Klhl28 T C 12: 64,943,526 D547G possibly damaging Het
Leng8 G C 7: 4,143,898 R473P probably damaging Het
Lin37 T A 7: 30,557,630 N53Y possibly damaging Het
Lrp1 G A 10: 127,595,110 Q357* probably null Het
Lrrfip2 A T 9: 111,205,772 K176N probably damaging Het
Ltbp4 A G 7: 27,328,761 S390P unknown Het
Map3k2 G A 18: 32,220,572 R465H possibly damaging Het
Mthfd1 T A 12: 76,303,743 V665E probably damaging Het
Myh3 A T 11: 67,098,625 I1524F probably benign Het
Myo1g A G 11: 6,516,153 S339P possibly damaging Het
Nf1 A G 11: 79,559,506 K506R probably damaging Het
Nudt21 A G 8: 94,019,693 I225T probably benign Het
Olfr1009 T A 2: 85,722,183 Y259* probably null Het
Olfr1183 A G 2: 88,461,598 K105R probably benign Het
Olfr147 A G 9: 38,403,222 Y116C probably damaging Het
Olfr504 A T 7: 108,565,573 L74Q probably benign Het
Olfr896-ps1 A T 9: 38,292,673 I243F probably damaging Het
Pax2 C T 19: 44,818,529 T299I probably benign Het
Pde4dip C T 3: 97,841,728 S99N probably damaging Het
Pdlim5 T A 3: 142,304,413 H147L possibly damaging Het
Pfkfb3 T A 2: 11,482,570 Y343F probably damaging Het
Phf10 A G 17: 14,954,120 I232T probably damaging Het
Plcb3 C T 19: 6,958,920 G745D probably benign Het
Pramef6 G A 4: 143,897,811 L39F probably damaging Het
Recql C A 6: 142,376,789 C129F possibly damaging Het
Rrp1 C T 10: 78,405,042 D288N unknown Het
Samd4 T C 14: 47,016,609 Y177H probably benign Het
Sim1 T A 10: 50,909,429 M198K possibly damaging Het
Six4 T C 12: 73,109,190 I334M probably damaging Het
Slc27a6 T C 18: 58,572,196 S217P probably damaging Het
Slc2a4 T A 11: 69,945,392 K264N probably benign Het
Slc8b1 A T 5: 120,532,874 I476F probably benign Het
Smcp T C 3: 92,584,531 D3G unknown Het
Tagap A T 17: 7,933,503 M507L probably benign Het
Thap11 A G 8: 105,856,148 E263G probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Top3a T G 11: 60,763,427 probably null Het
Vmn1r31 A G 6: 58,472,088 V264A unknown Het
Vti1a A C 19: 55,328,433 M81L probably benign Het
Wscd1 T C 11: 71,783,419 probably null Het
Zfp595 T C 13: 67,316,612 E532G probably damaging Het
Zranb1 T A 7: 132,982,438 V539D probably damaging Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R0799:Adgra2 UTSW 8 27112495 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1601:Adgra2 UTSW 8 27110018 splice site probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2164:Adgra2 UTSW 8 27114204 nonsense probably null
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4724:Adgra2 UTSW 8 27098822 missense possibly damaging 0.91
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R5718:Adgra2 UTSW 8 27113486 critical splice donor site probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
R7861:Adgra2 UTSW 8 27114457 missense probably damaging 0.98
R7882:Adgra2 UTSW 8 27117412 missense probably benign 0.15
R8069:Adgra2 UTSW 8 27119223 missense probably benign 0.01
R8146:Adgra2 UTSW 8 27114174 missense probably damaging 0.99
R9080:Adgra2 UTSW 8 27114501 missense probably benign 0.02
R9135:Adgra2 UTSW 8 27120951 missense probably damaging 1.00
R9425:Adgra2 UTSW 8 27086066 missense probably benign 0.04
R9473:Adgra2 UTSW 8 27120915 missense probably damaging 0.99
R9643:Adgra2 UTSW 8 27122003 missense possibly damaging 0.48
R9648:Adgra2 UTSW 8 27119144 missense probably damaging 1.00
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGTGGTCTGGTGTCACAGTC -3'
(R):5'- CTTAATGCACACCCAGGAATCG -3'

Sequencing Primer
(F):5'- CTGGTGTCACAGTCCTGGG -3'
(R):5'- CACCAGCACAAAGGTGTA -3'
Posted On 2021-12-30