Incidental Mutation 'R1601:Adgra2'
ID176154
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Nameadhesion G protein-coupled receptor A2
SynonymsTem5, 8430414O08Rik, Gpr124, 9530074E10Rik
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1601 (G1)
Quality Score177
Status Not validated
Chromosome8
Chromosomal Location27085583-27123436 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 27110018 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514]
Predicted Effect probably null
Transcript: ENSMUST00000033876
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178514
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179207
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R0799:Adgra2 UTSW 8 27112495 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2164:Adgra2 UTSW 8 27114204 nonsense probably null
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4724:Adgra2 UTSW 8 27098822 missense possibly damaging 0.91
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R5718:Adgra2 UTSW 8 27113486 critical splice donor site probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
R7861:Adgra2 UTSW 8 27114457 missense probably damaging 0.98
R7882:Adgra2 UTSW 8 27117412 missense probably benign 0.15
R7944:Adgra2 UTSW 8 27114457 missense probably damaging 0.98
R7965:Adgra2 UTSW 8 27117412 missense probably benign 0.15
R8069:Adgra2 UTSW 8 27119223 missense not run
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAATCGGATTGGCTGTCTCACCTC -3'
(R):5'- GCCTAACCAACAGGCATGATGCTC -3'

Sequencing Primer
(F):5'- ggaaagggaggggaggg -3'
(R):5'- GTGTTGAATAAAGAATGGGAGTTTG -3'
Posted On2014-04-24