Incidental Mutation 'R9320:Bicdl1'
ID 706081
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene Name BICD family like cargo adaptor 1
Synonyms 2210403N09Rik, Ccdc64, BICDR-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R9320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 115648175-115731621 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115724710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 162 (R162L)
Ref Sequence ENSEMBL: ENSMUSP00000053547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055408] [ENSMUST00000141950]
AlphaFold A0JNT9
Predicted Effect probably damaging
Transcript: ENSMUST00000055408
AA Change: R162L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609
AA Change: R162L

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141950
AA Change: R98L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119015
Gene: ENSMUSG00000041609
AA Change: R98L

DomainStartEndE-ValueType
Pfam:HAP1_N 35 99 4.5e-11 PFAM
coiled coil region 192 236 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,097 Y1451H probably damaging Het
Abca7 T A 10: 79,997,637 M8K possibly damaging Het
Ablim3 C A 18: 61,839,734 R238L probably damaging Het
Adar T A 3: 89,751,061 Y1141* probably null Het
Arid2 T C 15: 96,371,186 I1060T probably damaging Het
Armc2 A T 10: 41,963,778 V397D possibly damaging Het
Astn2 A G 4: 66,404,149 V71A unknown Het
Bcat2 A G 7: 45,585,118 D141G probably damaging Het
Btbd17 A G 11: 114,794,084 I43T possibly damaging Het
C2cd5 A T 6: 143,031,293 C698* probably null Het
Calr T A 8: 84,846,000 K87* probably null Het
Cap2 C T 13: 46,615,342 T208I probably benign Het
Col14a1 A T 15: 55,501,384 M1630L probably benign Het
Copg1 T G 6: 87,910,090 S816A possibly damaging Het
Csf2ra C A 19: 61,226,842 A112S possibly damaging Het
Cwc27 T A 13: 104,797,291 H241L probably benign Het
Dgki T A 6: 36,915,487 E852V probably damaging Het
Dpp6 T C 5: 27,663,523 probably null Het
Dynlrb1 T C 2: 155,247,940 probably null Het
Ehhadh C T 16: 21,773,531 V141I probably benign Het
Esyt3 A G 9: 99,311,991 L865P probably damaging Het
Fam83h T A 15: 76,002,075 T1138S possibly damaging Het
Fzd4 T C 7: 89,407,704 W320R probably damaging Het
Gimap7 A T 6: 48,724,326 K282M probably benign Het
Gm13212 C G 4: 145,622,586 Q198E possibly damaging Het
Gnai2 G A 9: 107,615,714 T330I Het
Gpr107 T C 2: 31,188,716 S388P possibly damaging Het
Il1a T G 2: 129,300,734 M264L probably benign Het
Ints10 A T 8: 68,827,299 I693F probably damaging Het
Jak3 A T 8: 71,681,621 N456Y probably benign Het
Krcc1 A G 6: 71,284,473 E163G probably benign Het
Lctl A G 9: 64,133,173 Y466C probably damaging Het
Lrp12 A T 15: 39,877,961 S472T probably damaging Het
Lrp1b A G 2: 41,445,099 probably null Het
Lrriq1 T A 10: 103,221,283 M219L probably benign Het
Mbl2 T A 19: 30,239,341 D184E probably damaging Het
Mrgpra9 G A 7: 47,235,644 R92C probably benign Het
Mroh4 G A 15: 74,611,556 T644I probably damaging Het
Muc5ac C T 7: 141,815,518 A3114V probably benign Het
Myh11 T A 16: 14,211,288 M1197L Het
Naga C T 15: 82,336,883 G71S probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nsd3 A G 8: 25,709,061 probably null Het
Nsun6 T C 2: 15,042,237 T101A probably benign Het
Olfr545 T A 7: 102,494,877 probably benign Het
Pabpc4l T A 3: 46,446,891 D106V probably damaging Het
Pdlim5 G A 3: 142,247,348 P529L probably damaging Het
Ralgapa1 A G 12: 55,709,058 L1111P possibly damaging Het
Rangap1 T C 15: 81,722,020 D40G probably benign Het
Ripor2 T C 13: 24,731,680 F1078L probably damaging Het
Ryr3 T C 2: 112,779,991 D2312G probably damaging Het
Siglecg T A 7: 43,409,429 I202N probably benign Het
Slco4c1 G T 1: 96,867,919 S138* probably null Het
Snx27 T C 3: 94,524,286 Y267C probably damaging Het
Sphk2 C T 7: 45,711,755 R275H probably damaging Het
Stk36 T A 1: 74,616,634 V432E possibly damaging Het
Tecrl C T 5: 83,280,575 S283N possibly damaging Het
Tenm2 T A 11: 36,023,647 E2354D probably damaging Het
Tmem59l A G 8: 70,485,172 V186A possibly damaging Het
Try4 T C 6: 41,305,074 probably null Het
Ubr1 C A 2: 120,896,519 G1248V probably benign Het
Umod C T 7: 119,466,132 G558E probably damaging Het
Unc13b T C 4: 43,171,044 F624S unknown Het
Uvssa T G 5: 33,390,021 D310E probably benign Het
Vmn1r222 A T 13: 23,232,248 M265K probably benign Het
Vmn1r3 A G 4: 3,185,284 F8L probably benign Het
Zfp386 T A 12: 116,059,897 C412S probably damaging Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115670156 nonsense probably null
IGL01902:Bicdl1 APN 5 115651874 missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115663885 missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115673158 missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115663822 missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115731160 missense probably damaging 1.00
bargain UTSW 5 115670153 critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115672143 critical splice donor site probably null
R0837:Bicdl1 UTSW 5 115731292 missense probably benign 0.06
R0924:Bicdl1 UTSW 5 115661528 splice site probably benign
R1581:Bicdl1 UTSW 5 115651267 unclassified probably benign
R1589:Bicdl1 UTSW 5 115651266 unclassified probably benign
R1669:Bicdl1 UTSW 5 115656016 missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115655928 missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115661478 missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115670153 critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115672143 critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115670170 missense probably benign 0.03
R7157:Bicdl1 UTSW 5 115651857 missense possibly damaging 0.92
R7205:Bicdl1 UTSW 5 115670281 missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115663786 nonsense probably null
R7781:Bicdl1 UTSW 5 115661487 missense probably damaging 1.00
R8816:Bicdl1 UTSW 5 115724745 missense probably damaging 1.00
R9527:Bicdl1 UTSW 5 115673129 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACTCACCCTGCTGAGTTG -3'
(R):5'- AGACAAGTCCTGTGTTCTAGAAGAG -3'

Sequencing Primer
(F):5'- ACCCTGCTGAGTTGGTCCAG -3'
(R):5'- CTGTGAATTGGGCAACATGC -3'
Posted On 2022-03-25