Incidental Mutation 'R0743:Bend7'
ID70751
Institutional Source Beutler Lab
Gene Symbol Bend7
Ensembl Gene ENSMUSG00000048186
Gene NameBEN domain containing 7
Synonyms
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location4717831-4802142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4744244 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 57 (K57N)
Ref Sequence ENSEMBL: ENSMUSP00000139220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056914] [ENSMUST00000115022] [ENSMUST00000184139]
Predicted Effect probably damaging
Transcript: ENSMUST00000056914
AA Change: K57N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052458
Gene: ENSMUSG00000048186
AA Change: K57N

DomainStartEndE-ValueType
low complexity region 213 220 N/A INTRINSIC
BEN 311 395 5.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115022
AA Change: K57N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110674
Gene: ENSMUSG00000048186
AA Change: K57N

DomainStartEndE-ValueType
low complexity region 213 220 N/A INTRINSIC
BEN 311 395 5.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184139
AA Change: K57N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139220
Gene: ENSMUSG00000048186
AA Change: K57N

DomainStartEndE-ValueType
low complexity region 213 220 N/A INTRINSIC
BEN 311 395 5.12e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Bend7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02541:Bend7 APN 2 4763305 critical splice donor site probably null
R0884:Bend7 UTSW 2 4744244 missense probably damaging 1.00
R1459:Bend7 UTSW 2 4744428 missense probably damaging 0.96
R1544:Bend7 UTSW 2 4763311 splice site probably benign
R2344:Bend7 UTSW 2 4788534 missense probably damaging 1.00
R4372:Bend7 UTSW 2 4749610 missense probably damaging 1.00
R4838:Bend7 UTSW 2 4744322 missense probably damaging 1.00
R5226:Bend7 UTSW 2 4752978 nonsense probably null
R5291:Bend7 UTSW 2 4763241 missense probably damaging 1.00
R5292:Bend7 UTSW 2 4763241 missense probably damaging 1.00
R5347:Bend7 UTSW 2 4763241 missense probably damaging 1.00
R5695:Bend7 UTSW 2 4763241 missense probably damaging 1.00
R5729:Bend7 UTSW 2 4763274 missense probably damaging 1.00
R5816:Bend7 UTSW 2 4744332 missense probably damaging 1.00
R5816:Bend7 UTSW 2 4752899 missense probably benign 0.18
R5944:Bend7 UTSW 2 4744356 missense probably damaging 1.00
R6127:Bend7 UTSW 2 4763277 missense probably damaging 1.00
R6185:Bend7 UTSW 2 4788522 missense probably damaging 1.00
R7288:Bend7 UTSW 2 4752830 missense probably damaging 0.98
R7524:Bend7 UTSW 2 4799980 missense probably benign 0.00
R7797:Bend7 UTSW 2 4749644 missense probably damaging 0.96
R8022:Bend7 UTSW 2 4752779 missense probably benign 0.00
R8141:Bend7 UTSW 2 4752825 missense probably benign 0.00
R8156:Bend7 UTSW 2 4752854 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCTTGCTGAATGATTTCAGAGTGTGGA -3'
(R):5'- TGGACCAGACTGCCCTGAGAACTG -3'

Sequencing Primer
(F):5'- AGAGTGTGGAATCAGTATTTTTTCCC -3'
(R):5'- TGAGAACTGCCCGCTTTG -3'
Posted On2013-09-30