Incidental Mutation 'R0743:Glrb'
ID70759
Institutional Source Beutler Lab
Gene Symbol Glrb
Ensembl Gene ENSMUSG00000028020
Gene Nameglycine receptor, beta subunit
Synonyms
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location80843599-80913660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80879680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 59 (I59F)
Ref Sequence ENSEMBL: ENSMUSP00000142306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029654] [ENSMUST00000107743] [ENSMUST00000132330] [ENSMUST00000135043] [ENSMUST00000194085]
Predicted Effect probably damaging
Transcript: ENSMUST00000029654
AA Change: I59F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029654
Gene: ENSMUSG00000028020
AA Change: I59F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 6.9e-55 PFAM
Pfam:Neur_chan_memb 273 492 4.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107743
AA Change: I59F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103372
Gene: ENSMUSG00000028020
AA Change: I59F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 5.7e-58 PFAM
Pfam:Neur_chan_memb 273 302 9.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132330
SMART Domains Protein: ENSMUSP00000115014
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000135043
SMART Domains Protein: ENSMUSP00000116604
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194085
AA Change: I59F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142306
Gene: ENSMUSG00000028020
AA Change: I59F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 264 6.9e-55 PFAM
Pfam:Neur_chan_memb 248 441 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. This gene is transcribed throughout the central nervous system of neonatal and adult mice. In humans, mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mutations in this gene result in a neurological disorder and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Glrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Glrb APN 3 80861955 missense probably damaging 1.00
IGL00850:Glrb APN 3 80861781 missense probably damaging 1.00
IGL01970:Glrb APN 3 80861925 missense possibly damaging 0.92
IGL02023:Glrb APN 3 80850955 missense probably benign 0.22
IGL02494:Glrb APN 3 80845232 missense probably benign 0.01
IGL02703:Glrb APN 3 80850993 missense probably benign 0.19
I1329:Glrb UTSW 3 80862074 missense probably damaging 1.00
R0003:Glrb UTSW 3 80855914 missense probably damaging 1.00
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0010:Glrb UTSW 3 80860315 splice site probably benign
R1367:Glrb UTSW 3 80862004 missense probably damaging 1.00
R1491:Glrb UTSW 3 80911975 missense possibly damaging 0.81
R1699:Glrb UTSW 3 80861774 missense probably damaging 1.00
R1791:Glrb UTSW 3 80860175 missense probably damaging 1.00
R1802:Glrb UTSW 3 80861957 missense probably damaging 1.00
R2420:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2422:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2517:Glrb UTSW 3 80861747 missense probably damaging 1.00
R3612:Glrb UTSW 3 80862030 missense possibly damaging 0.89
R4287:Glrb UTSW 3 80845232 missense possibly damaging 0.84
R4382:Glrb UTSW 3 80879639 missense probably damaging 1.00
R4546:Glrb UTSW 3 80879686 missense probably damaging 0.99
R4874:Glrb UTSW 3 80851042 missense possibly damaging 0.84
R5816:Glrb UTSW 3 80861979 missense probably damaging 1.00
R5826:Glrb UTSW 3 80845142 missense probably damaging 0.99
R6711:Glrb UTSW 3 80844974 missense probably benign 0.02
R7738:Glrb UTSW 3 80860184 missense probably damaging 0.98
Z1088:Glrb UTSW 3 80845234 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCTCTTTCCCTAAGCACATTTCAGGAC -3'
(R):5'- GTAAACAGATCACCCTGCCTCTGAC -3'

Sequencing Primer
(F):5'- CCTAAGCACATTTCAGGACAGTTAAG -3'
(R):5'- CTTCTCCTTTAGTCAGCAGTCAC -3'
Posted On2013-09-30