Incidental Mutation 'R9491:Incenp'
ID 716961
Institutional Source Beutler Lab
Gene Symbol Incenp
Ensembl Gene ENSMUSG00000024660
Gene Name inner centromere protein
Synonyms 2700067E22Rik
Accession Numbers

Genbank: NM_016692

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9491 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 9872297-9899533 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9876777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 637 (K637E)
Ref Sequence ENSEMBL: ENSMUSP00000025562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025562]
AlphaFold Q9WU62
Predicted Effect unknown
Transcript: ENSMUST00000025562
AA Change: K637E
SMART Domains Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: K637E

DomainStartEndE-ValueType
Pfam:INCENP_N 6 41 1.9e-18 PFAM
low complexity region 83 94 N/A INTRINSIC
low complexity region 123 145 N/A INTRINSIC
low complexity region 308 314 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 517 553 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
SCOP:d1f5na1 631 739 7e-3 SMART
Pfam:INCENP_ARK-bind 789 846 1.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G A 9: 106,435,795 T142I probably damaging Het
Adcy9 T C 16: 4,418,188 E453G probably damaging Het
Ank3 A C 10: 70,002,509 probably null Het
Asmt G A X: 170,674,670 G103D possibly damaging Het
Cap2 C T 13: 46,637,890 P290S possibly damaging Het
Cfap43 A T 19: 47,812,066 probably null Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Clstn1 T C 4: 149,647,472 S950P probably damaging Het
Cluap1 G A 16: 3,940,868 R398Q probably benign Het
Cmbl G T 15: 31,581,973 V39L probably benign Het
Dapk1 A G 13: 60,729,555 D536G probably benign Het
Ddx3y T A Y: 1,279,465 D133V probably benign Het
Duox1 T A 2: 122,326,426 S525T probably benign Het
Eif2s2 T C 2: 154,892,710 probably benign Het
Fam109a G A 5: 121,852,988 A138T probably benign Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gadd45a A T 6: 67,035,746 D137E probably benign Het
Gmppa A G 1: 75,438,958 D120G probably damaging Het
Gpr156 A T 16: 38,005,342 R640S probably benign Het
Grik1 A T 16: 87,950,107 M414K Het
Gtse1 C T 15: 85,871,533 P466L probably damaging Het
H6pd T A 4: 149,995,909 N160Y probably benign Het
Hectd4 T G 5: 121,314,918 L496R probably damaging Het
Hnrnpk G T 13: 58,393,236 Q441K probably benign Het
Irgc1 C T 7: 24,432,924 R156H probably benign Het
Kazn C T 4: 142,118,125 A383T Het
Lmln A G 16: 33,069,988 E169G possibly damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mdfic T A 6: 15,799,853 C326* probably null Het
Ncoa1 T A 12: 4,290,912 D840V probably benign Het
Nkd1 A G 8: 88,574,247 D81G probably benign Het
Olfr250 T C 9: 38,367,675 V33A possibly damaging Het
Olfr262 T C 19: 12,241,242 T140A probably benign Het
Parp4 G A 14: 56,595,371 E384K probably damaging Het
Pcdhgb4 T A 18: 37,721,842 L430H probably damaging Het
Pdgfrb A G 18: 61,078,984 Y861C probably damaging Het
Pipox T A 11: 77,881,533 Y337F probably benign Het
Prcc A G 3: 87,867,364 V377A probably benign Het
Prrg2 T A 7: 45,056,794 Y133F probably damaging Het
Ptchd3 T C 11: 121,842,987 V901A probably damaging Het
Rgl1 A G 1: 152,549,118 L335P probably damaging Het
Setx T A 2: 29,147,823 M1440K probably benign Het
Smchd1 A G 17: 71,360,025 probably null Het
Tbpl2 T C 2: 24,096,520 I6V probably benign Het
Tdrd12 T A 7: 35,489,264 H516L Het
Tmem8b C T 4: 43,673,938 R190C probably damaging Het
Tpmt A T 13: 47,027,276 S196T probably benign Het
Trp63 A G 16: 25,876,722 N478S unknown Het
Vstm5 T G 9: 15,257,290 I50S probably damaging Het
Wdhd1 A T 14: 47,268,159 C285* probably null Het
Zdhhc23 A C 16: 43,973,699 V204G probably benign Het
Zfp653 T A 9: 22,058,326 K215* probably null Het
Other mutations in Incenp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Incenp APN 19 9883728 missense unknown
IGL01717:Incenp APN 19 9893265 splice site probably benign
IGL02485:Incenp APN 19 9893368 missense unknown
IGL02488:Incenp APN 19 9893407 missense unknown
B5639:Incenp UTSW 19 9893818 missense unknown
R0060:Incenp UTSW 19 9885459 splice site probably benign
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0242:Incenp UTSW 19 9893750 missense unknown
R0242:Incenp UTSW 19 9893750 missense unknown
R0284:Incenp UTSW 19 9893993 missense unknown
R1264:Incenp UTSW 19 9884015 missense unknown
R1432:Incenp UTSW 19 9885526 missense unknown
R1679:Incenp UTSW 19 9895414 missense unknown
R1827:Incenp UTSW 19 9872729 missense possibly damaging 0.94
R1970:Incenp UTSW 19 9885487 missense unknown
R3082:Incenp UTSW 19 9883779 missense unknown
R3083:Incenp UTSW 19 9883779 missense unknown
R4062:Incenp UTSW 19 9883778 missense unknown
R4063:Incenp UTSW 19 9883778 missense unknown
R4534:Incenp UTSW 19 9883939 missense unknown
R4535:Incenp UTSW 19 9883939 missense unknown
R4536:Incenp UTSW 19 9883939 missense unknown
R4709:Incenp UTSW 19 9876600 missense unknown
R4785:Incenp UTSW 19 9877690 missense unknown
R4785:Incenp UTSW 19 9877691 missense unknown
R5179:Incenp UTSW 19 9894909 missense unknown
R5282:Incenp UTSW 19 9878406 missense unknown
R5400:Incenp UTSW 19 9877675 critical splice donor site probably null
R5502:Incenp UTSW 19 9893364 missense unknown
R5608:Incenp UTSW 19 9893868 small insertion probably benign
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6807:Incenp UTSW 19 9877756 missense unknown
R6885:Incenp UTSW 19 9875132 missense unknown
R6959:Incenp UTSW 19 9876770 missense unknown
R7033:Incenp UTSW 19 9893372 missense unknown
R8258:Incenp UTSW 19 9893629 missense unknown
R8258:Incenp UTSW 19 9893641 missense unknown
R8259:Incenp UTSW 19 9893629 missense unknown
R8259:Incenp UTSW 19 9893641 missense unknown
R8293:Incenp UTSW 19 9875133 nonsense probably null
R9005:Incenp UTSW 19 9877724 nonsense probably null
R9665:Incenp UTSW 19 9893965 missense unknown
Z1176:Incenp UTSW 19 9877687 missense unknown
Z1177:Incenp UTSW 19 9899364 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACACAGGACAGTAGTAAATGGTC -3'
(R):5'- GTCCTACCTGATGTCATGGTGG -3'

Sequencing Primer
(F):5'- TCACCTCTTGGCCCGAAGAC -3'
(R):5'- GTAGTCAGTGCCTTAGGAGC -3'
Posted On 2022-07-18