Incidental Mutation 'R0771:Gm9733'
ID76945
Institutional Source Beutler Lab
Gene Symbol Gm9733
Ensembl Gene ENSMUSG00000078783
Gene Namepredicted gene 9733
Synonyms
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location15296551-15332302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15320446 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000103998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108361]
Predicted Effect probably benign
Transcript: ENSMUST00000108361
AA Change: Q132L

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103998
Gene: ENSMUSG00000078783
AA Change: Q132L

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 37 142 6.71e-5 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lim2 C A 7: 43,430,703 A38E possibly damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mdh1 C T 11: 21,557,550 V300I probably benign Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Ncapg2 T A 12: 116,413,159 C122* probably null Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Olfr686 T A 7: 105,204,161 M61L possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Slc1a4 C T 11: 20,306,467 V455M probably damaging Het
Srbd1 T A 17: 86,130,254 E220D probably benign Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Gm9733
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm9733 APN 3 15332145 splice site probably null
IGL03104:Gm9733 APN 3 15332223 utr 5 prime probably benign
R0239:Gm9733 UTSW 3 15296601 missense probably damaging 1.00
R0239:Gm9733 UTSW 3 15296601 missense probably damaging 1.00
R1452:Gm9733 UTSW 3 15332152 missense unknown
R1541:Gm9733 UTSW 3 15320684 missense possibly damaging 0.59
R5124:Gm9733 UTSW 3 15320579 nonsense probably null
R5328:Gm9733 UTSW 3 15332174 missense unknown
R5991:Gm9733 UTSW 3 15320758 missense probably benign 0.00
R6333:Gm9733 UTSW 3 15320611 missense probably damaging 1.00
R6656:Gm9733 UTSW 3 15320498 missense probably damaging 0.99
R7270:Gm9733 UTSW 3 15320644 missense probably benign 0.18
R7615:Gm9733 UTSW 3 15320485 missense probably damaging 1.00
R7799:Gm9733 UTSW 3 15296663 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCAAGAAAGTCAGTCCTCTGTG -3'
(R):5'- TTTAAACTGCACTGTGACCTCCCTG -3'

Sequencing Primer
(F):5'- CCTCTGTGGCTTTATATAGTCAATAG -3'
(R):5'- GCCCATAAAGTGGATCAGAAAAATG -3'
Posted On2013-10-16