Incidental Mutation 'R5234:Pthlh'
ID398212
Institutional Source Beutler Lab
Gene Symbol Pthlh
Ensembl Gene ENSMUSG00000048776
Gene Nameparathyroid hormone-like peptide
Synonymsparathyroid hormone-like hormone, PTH-related peptide, parathyroid hormone-related peptide, parathyroid hormone-related protein, PTH-like, Pthrp
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location147252101-147264183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 147257094 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 123 (G123W)
Ref Sequence ENSEMBL: ENSMUSP00000145509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052296] [ENSMUST00000204197]
Predicted Effect probably damaging
Transcript: ENSMUST00000052296
AA Change: G123W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051433
Gene: ENSMUSG00000048776
AA Change: G123W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204197
AA Change: G123W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145509
Gene: ENSMUSG00000048776
AA Change: G123W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the parathyroid family of hormones that possesses distinct paracrine and intracrine signaling roles such as regulation of circulating calcium, transplacental calcium transport, osteoclast inhibition, renal bicarbonate excretion and regulation of apoptosis. The encoded protein undergoes proteolytic processing to generate multiple active peptides with distinct signaling functions. The homozygous deletion of this gene leads to death shortly after birth with a chondrodystrophic phenotype characterized by premature chondrocyte differentiation and accelerated bone formation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dischondroplasia associated with premature maturation of chondrocytes and die postnatally from asphyxia. Mutants rescued from neonatal lethality lack mammary development and tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Pthlh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Pthlh APN 6 147252575 missense probably benign 0.15
IGL02450:Pthlh APN 6 147257168 missense possibly damaging 0.95
R0847:Pthlh UTSW 6 147263268 critical splice donor site probably null
R2171:Pthlh UTSW 6 147257196 missense probably damaging 1.00
R2174:Pthlh UTSW 6 147257012 missense probably benign 0.00
R3123:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R3124:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R3125:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R4660:Pthlh UTSW 6 147257298 missense probably damaging 1.00
R5244:Pthlh UTSW 6 147257153 missense probably damaging 1.00
R5809:Pthlh UTSW 6 147257247 missense probably damaging 0.99
R6475:Pthlh UTSW 6 147257190 missense probably damaging 0.98
R7548:Pthlh UTSW 6 147257155 missense possibly damaging 0.56
R8144:Pthlh UTSW 6 147257165 missense probably damaging 1.00
Z1177:Pthlh UTSW 6 147263342 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGCTGAACACAGTGAACAGTAC -3'
(R):5'- CAAGGGCAAGTCCATCCAAG -3'

Sequencing Primer
(F):5'- TGAACAGTACCTTAAGCTGGGCTC -3'
(R):5'- GTCCATCCAAGACTTGCGC -3'
Posted On2016-07-06