Incidental Mutation 'R0947:Olfr1505'
ID81687
Institutional Source Beutler Lab
Gene Symbol Olfr1505
Ensembl Gene ENSMUSG00000062314
Gene Nameolfactory receptor 1505
SynonymsMOR211-4P, GA_x6K02T2RE5P-4250267-4251217, MOR211-10_i
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0947 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13913530-13921866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13919171 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 50 (H50Q)
Ref Sequence ENSEMBL: ENSMUSP00000148945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081520] [ENSMUST00000216623] [ENSMUST00000216835]
Predicted Effect probably benign
Transcript: ENSMUST00000081520
AA Change: H50Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080235
Gene: ENSMUSG00000062314
AA Change: H50Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-43 PFAM
Pfam:7tm_1 41 290 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216623
AA Change: H50Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216835
AA Change: H50Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Lrrc32 A G 7: 98,498,883 D290G probably benign Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pbx1 A G 1: 168,203,366 S228P probably damaging Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Prom2 G T 2: 127,538,263 Q350K possibly damaging Het
Racgap1 C T 15: 99,624,314 A458T possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Sgk2 T A 2: 163,006,838 D269E probably benign Het
Spsb1 T C 4: 149,907,079 T11A probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Olfr1505
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr1505 APN 19 13919528 nonsense probably null
IGL03388:Olfr1505 APN 19 13919620 missense probably damaging 0.99
R0143:Olfr1505 UTSW 19 13919250 missense probably damaging 1.00
R0326:Olfr1505 UTSW 19 13919509 missense probably benign 0.13
R0602:Olfr1505 UTSW 19 13919781 missense probably benign 0.13
R0624:Olfr1505 UTSW 19 13919444 missense probably damaging 0.99
R1472:Olfr1505 UTSW 19 13919844 missense probably damaging 1.00
R1691:Olfr1505 UTSW 19 13919419 missense probably benign 0.00
R2991:Olfr1505 UTSW 19 13919311 missense probably damaging 1.00
R4296:Olfr1505 UTSW 19 13919353 missense probably damaging 1.00
R4688:Olfr1505 UTSW 19 13919241 missense probably benign 0.01
R4814:Olfr1505 UTSW 19 13919453 missense possibly damaging 0.50
R4823:Olfr1505 UTSW 19 13919658 missense probably benign 0.02
R5038:Olfr1505 UTSW 19 13919458 missense possibly damaging 0.58
R5243:Olfr1505 UTSW 19 13919661 missense probably damaging 1.00
R5323:Olfr1505 UTSW 19 13919616 missense possibly damaging 0.95
R5542:Olfr1505 UTSW 19 13919047 missense probably benign 0.04
R5918:Olfr1505 UTSW 19 13919775 missense probably damaging 1.00
R6011:Olfr1505 UTSW 19 13919157 missense probably benign 0.00
R6159:Olfr1505 UTSW 19 13919740 missense probably damaging 1.00
R7535:Olfr1505 UTSW 19 13919085 missense probably benign
R8262:Olfr1505 UTSW 19 13919862 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTAGATGCCTACAGAGCAGATGTGAG -3'
(R):5'- GATCATAGGCCATCACAGACAGCAG -3'

Sequencing Primer
(F):5'- AACGACTATCCTTCAGTTGTGG -3'
(R):5'- CAGCAGGAAACATTCTGTAGC -3'
Posted On2013-11-08