Incidental Mutation 'R0866:Hmox1'
ID82350
Institutional Source Beutler Lab
Gene Symbol Hmox1
Ensembl Gene ENSMUSG00000005413
Gene Nameheme oxygenase 1
SynonymsHO1, HO-1, D8Wsu38e, heme oxygenase 1, Hmox, Hsp32
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R0866 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75093621-75100589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75097303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 200 (T200A)
Ref Sequence ENSEMBL: ENSMUSP00000005548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005548]
Predicted Effect probably benign
Transcript: ENSMUST00000005548
AA Change: T200A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005548
Gene: ENSMUSG00000005413
AA Change: T200A

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 11 216 7.3e-85 PFAM
transmembrane domain 266 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159631
SMART Domains Protein: ENSMUSP00000135466
Gene: ENSMUSG00000005413

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 3 158 4.2e-66 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit low serum iron levels, increased hepatic and renal iron, oxidative damage, tissue injury, chronic inflammation, reduced neuronal proliferation, and increased sensitivity to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Hmox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0194:Hmox1 UTSW 8 75097108 missense probably damaging 1.00
R1469:Hmox1 UTSW 8 75098835 missense probably benign
R1469:Hmox1 UTSW 8 75098835 missense probably benign
R1559:Hmox1 UTSW 8 75099949 missense probably damaging 0.97
R6027:Hmox1 UTSW 8 75096871 missense probably damaging 1.00
R7194:Hmox1 UTSW 8 75096923 missense probably benign 0.01
R7308:Hmox1 UTSW 8 75097019 missense probably damaging 1.00
R8403:Hmox1 UTSW 8 75097331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACAGCACTATGTAAAGCGTC -3'
(R):5'- TTACTCCTCCCACAGGGACTGAAC -3'

Sequencing Primer
(F):5'- TATGTAAAGCGTCTCCACGAG -3'
(R):5'- ggaggataaagagatttgcccac -3'
Posted On2013-11-08