Incidental Mutation 'R1148:Ly6h'
ID102539
Institutional Source Beutler Lab
Gene Symbol Ly6h
Ensembl Gene ENSMUSG00000022577
Gene Namelymphocyte antigen 6 complex, locus H
Synonyms
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R1148 (G1)
Quality Score222
Status Validated
Chromosome15
Chromosomal Location75551268-75567255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75565172 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 118 (S118R)
Ref Sequence ENSEMBL: ENSMUSP00000130781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023241] [ENSMUST00000065417] [ENSMUST00000126129] [ENSMUST00000127095] [ENSMUST00000156032] [ENSMUST00000163116]
Predicted Effect unknown
Transcript: ENSMUST00000023241
AA Change: S118R
SMART Domains Protein: ENSMUSP00000023241
Gene: ENSMUSG00000022577
AA Change: S118R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LU 26 123 2.68e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000065417
AA Change: S118R
SMART Domains Protein: ENSMUSP00000070646
Gene: ENSMUSG00000022577
AA Change: S118R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LU 26 123 2.68e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126129
AA Change: S118R
SMART Domains Protein: ENSMUSP00000121951
Gene: ENSMUSG00000022577
AA Change: S118R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LU 26 123 2.68e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127095
AA Change: S139R
SMART Domains Protein: ENSMUSP00000122061
Gene: ENSMUSG00000022577
AA Change: S139R

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
LU 47 144 2.68e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150125
Predicted Effect unknown
Transcript: ENSMUST00000156032
AA Change: S139R
SMART Domains Protein: ENSMUSP00000122878
Gene: ENSMUSG00000022577
AA Change: S139R

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
LU 47 144 2.68e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163116
AA Change: S118R
SMART Domains Protein: ENSMUSP00000130781
Gene: ENSMUSG00000022577
AA Change: S118R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LU 26 123 2.68e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228961
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Ly6h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Ly6h APN 15 75565099 utr 3 prime probably benign
R1148:Ly6h UTSW 15 75565172 missense unknown
R1265:Ly6h UTSW 15 75566183 missense probably benign 0.05
R1468:Ly6h UTSW 15 75566137 missense probably benign 0.09
R1468:Ly6h UTSW 15 75566137 missense probably benign 0.09
R2235:Ly6h UTSW 15 75565189 missense probably benign
R6918:Ly6h UTSW 15 75565658 missense probably damaging 0.99
Predicted Primers
Posted On2014-01-15