Incidental Mutation 'R1148:Osbpl11'
ID102542
Institutional Source Beutler Lab
Gene Symbol Osbpl11
Ensembl Gene ENSMUSG00000022807
Gene Nameoxysterol binding protein-like 11
SynonymsORP-11
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33185071-33243312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33227212 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 515 (F515S)
Ref Sequence ENSEMBL: ENSMUSP00000155873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039733] [ENSMUST00000232100] [ENSMUST00000232181]
Predicted Effect probably damaging
Transcript: ENSMUST00000039733
AA Change: F515S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039632
Gene: ENSMUSG00000022807
AA Change: F515S

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
PH 70 168 2.03e-14 SMART
low complexity region 257 268 N/A INTRINSIC
Pfam:Oxysterol_BP 383 749 1.9e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231617
Predicted Effect probably damaging
Transcript: ENSMUST00000232100
AA Change: F509S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000232181
AA Change: F515S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Osbpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Osbpl11 APN 16 33241745 missense probably damaging 1.00
IGL01084:Osbpl11 APN 16 33226851 splice site probably benign
IGL03009:Osbpl11 APN 16 33241730 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0472:Osbpl11 UTSW 16 33234444 nonsense probably null
R0508:Osbpl11 UTSW 16 33196095 missense probably benign
R0609:Osbpl11 UTSW 16 33234444 nonsense probably null
R0715:Osbpl11 UTSW 16 33241730 splice site probably benign
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1275:Osbpl11 UTSW 16 33185850 missense probably benign 0.10
R1459:Osbpl11 UTSW 16 33236329 missense probably damaging 1.00
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1591:Osbpl11 UTSW 16 33209983 missense probably benign 0.00
R1752:Osbpl11 UTSW 16 33204835 missense probably damaging 1.00
R1883:Osbpl11 UTSW 16 33214353 missense probably benign
R1916:Osbpl11 UTSW 16 33185843 missense probably benign
R1916:Osbpl11 UTSW 16 33210095 missense possibly damaging 0.82
R4369:Osbpl11 UTSW 16 33224648 missense probably damaging 1.00
R4649:Osbpl11 UTSW 16 33196082 missense probably benign 0.12
R4873:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R4875:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R6074:Osbpl11 UTSW 16 33209965 missense probably benign 0.28
R6274:Osbpl11 UTSW 16 33227056 missense probably damaging 1.00
R7007:Osbpl11 UTSW 16 33226939 missense possibly damaging 0.81
Predicted Primers
Posted On2014-01-15