Incidental Mutation 'R1437:Zbtb11'
ID161332
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Namezinc finger and BTB domain containing 11
SynonymsZNF-U69274, 9230110G02Rik
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location55973883-56008913 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 55991620 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
Predicted Effect probably null
Transcript: ENSMUST00000050248
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183440
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 56000602 nonsense probably null
IGL01107:Zbtb11 APN 16 56006007 missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55990931 missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55990343 missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55980610 missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55998160 missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55991008 missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55982350 missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55974189 missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 56000675 missense probably damaging 1.00
R0987:Zbtb11 UTSW 16 55990708 missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55990560 nonsense probably null
R1570:Zbtb11 UTSW 16 55990815 missense probably benign
R1658:Zbtb11 UTSW 16 55974225 missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55990682 missense probably benign
R2048:Zbtb11 UTSW 16 55998009 missense probably damaging 1.00
R2925:Zbtb11 UTSW 16 55974084 missense probably benign 0.00
R4072:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 56006065 missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 56000713 missense probably benign 0.02
R5757:Zbtb11 UTSW 16 56007029 missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55998073 missense probably benign 0.00
R6313:Zbtb11 UTSW 16 55990491 missense probably benign 0.03
R6461:Zbtb11 UTSW 16 56006871 missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 56006252 missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55990502 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATGATACTGAAGCTGGATGTGGTGATG -3'
(R):5'- TTTTCACTGTCCTCTTTCTGAGGAAGC -3'

Sequencing Primer
(F):5'- gctacatagcaaaaccatgcc -3'
(R):5'- ggaagcctgaattaggaggataac -3'
Posted On2014-03-14