Incidental Mutation 'R1530:Kin'
ID166518
Institutional Source Beutler Lab
Gene Symbol Kin
Ensembl Gene ENSMUSG00000037262
Gene NameKin17 DNA and RNA binding protein
SynonymsKin17
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location10080593-10092806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10092339 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 333 (V333A)
Ref Sequence ENSEMBL: ENSMUSP00000043614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290] [ENSMUST00000042512]
Predicted Effect probably benign
Transcript: ENSMUST00000042290
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042512
AA Change: V333A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043614
Gene: ENSMUSG00000037262
AA Change: V333A

DomainStartEndE-ValueType
ZnF_C2H2 26 50 2.35e1 SMART
Kin17_mid 52 178 5.41e-89 SMART
low complexity region 209 224 N/A INTRINSIC
low complexity region 242 258 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
KOW 334 361 1.97e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142773
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that forms intranuclear foci during proliferation and is redistributed in the nucleoplasm during the cell cycle. Short-wave ultraviolet light provokes the relocalization of the protein, suggesting its participation in the cellular response to DNA damage. Originally selected based on protein-binding with RecA antibodies, the mouse protein presents a limited similarity with a functional domain of the bacterial RecA protein, a characteristic shared by this human ortholog. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Kin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Kin APN 2 10080704 missense probably damaging 1.00
IGL00898:Kin APN 2 10080706 missense probably damaging 1.00
IGL00907:Kin APN 2 10080704 missense probably damaging 1.00
IGL00907:Kin APN 2 10080706 missense probably damaging 1.00
IGL00941:Kin APN 2 10080704 missense probably damaging 1.00
IGL00941:Kin APN 2 10080706 missense probably damaging 1.00
IGL00971:Kin APN 2 10090348 missense possibly damaging 0.88
IGL01570:Kin APN 2 10091952 missense probably benign 0.05
R0090:Kin UTSW 2 10085773 missense possibly damaging 0.53
R0656:Kin UTSW 2 10085720 splice site probably benign
R0827:Kin UTSW 2 10090376 splice site probably benign
R4879:Kin UTSW 2 10080644 missense probably benign 0.01
R6728:Kin UTSW 2 10090148 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCGGGAAACGGAAAGAGTCTTCAC -3'
(R):5'- TTGCCTGACTAGAAACAGATGCCAC -3'

Sequencing Primer
(F):5'- CCCTGGATGAGATCATGGAGC -3'
(R):5'- CAGTAGAGTTACACAGTGCCTTG -3'
Posted On2014-04-13