Incidental Mutation 'R1530:Olfr901'
ID166554
Institutional Source Beutler Lab
Gene Symbol Olfr901
Ensembl Gene ENSMUSG00000052058
Gene Nameolfactory receptor 901
SynonymsGA_x6K02T2PVTD-32123032-32123967, MOR162-8
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38429455-38432682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38430324 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 14 (I14T)
Ref Sequence ENSEMBL: ENSMUSP00000150506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063716] [ENSMUST00000216502] [ENSMUST00000216644]
Predicted Effect probably damaging
Transcript: ENSMUST00000063716
AA Change: I14T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066714
Gene: ENSMUSG00000052058
AA Change: I14T

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.2e-47 PFAM
Pfam:7tm_1 42 290 3.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216502
AA Change: I14T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216644
AA Change: I14T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Olfr901
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr901 APN 9 38430515 missense probably benign 0.20
IGL01875:Olfr901 APN 9 38430298 missense probably damaging 1.00
R0010:Olfr901 UTSW 9 38430920 missense possibly damaging 0.70
R1186:Olfr901 UTSW 9 38431101 missense possibly damaging 0.85
R1259:Olfr901 UTSW 9 38430873 missense probably damaging 0.99
R1273:Olfr901 UTSW 9 38430684 missense probably benign 0.05
R1475:Olfr901 UTSW 9 38430864 missense probably benign 0.30
R1591:Olfr901 UTSW 9 38430411 missense probably damaging 1.00
R1750:Olfr901 UTSW 9 38430690 missense probably damaging 1.00
R1756:Olfr901 UTSW 9 38430995 missense probably benign
R2080:Olfr901 UTSW 9 38431082 missense probably benign 0.01
R3081:Olfr901 UTSW 9 38431056 missense possibly damaging 0.82
R4174:Olfr901 UTSW 9 38431020 missense probably damaging 0.97
R4299:Olfr901 UTSW 9 38430812 missense probably damaging 1.00
R4898:Olfr901 UTSW 9 38430815 missense probably benign 0.01
R5068:Olfr901 UTSW 9 38430464 missense probably damaging 1.00
R5695:Olfr901 UTSW 9 38431176 missense probably benign 0.01
R5973:Olfr901 UTSW 9 38430331 missense probably damaging 0.99
R6929:Olfr901 UTSW 9 38431148 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGTCTGAGGTCGGAGCTAGGCTAT -3'
(R):5'- CTGTTTCACAAAACCCACCAGCATTTT -3'

Sequencing Primer
(F):5'- tccaggggttcaaaccaag -3'
(R):5'- CCACCAGCATTTTGGGGG -3'
Posted On2014-04-13