Incidental Mutation 'R1530:Scn5a'
ID166557
Institutional Source Beutler Lab
Gene Symbol Scn5a
Ensembl Gene ENSMUSG00000032511
Gene Namesodium channel, voltage-gated, type V, alpha
SynonymsNav1.5c, Nav1.5, mH1, SkM2
MMRRC Submission 039569-MU
Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119483408-119579016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119495562 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1400 (K1400R)
Ref Sequence ENSEMBL: ENSMUSP00000066228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420]
Predicted Effect probably damaging
Transcript: ENSMUST00000065196
AA Change: K1400R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: K1400R

DomainStartEndE-ValueType
Pfam:Ion_trans 130 423 2.4e-82 PFAM
Pfam:Na_trans_cytopl 478 667 5.2e-49 PFAM
Pfam:Ion_trans 716 950 1.1e-54 PFAM
Pfam:Na_trans_assoc 955 1203 2.9e-57 PFAM
Pfam:Ion_trans 1207 1484 2e-66 PFAM
Pfam:Ion_trans 1530 1786 7.2e-55 PFAM
Pfam:PKD_channel 1627 1780 3.5e-7 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117911
AA Change: K1400R

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: K1400R

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 9.6e-76 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 4.9e-44 PFAM
Pfam:Ion_trans 751 940 2.3e-46 PFAM
Pfam:Na_trans_assoc 955 1218 1.2e-73 PFAM
Pfam:Ion_trans 1244 1472 2e-56 PFAM
PDB:1BYY|A 1474 1526 5e-29 PDB
Pfam:Ion_trans 1565 1774 1.5e-49 PFAM
Pfam:PKD_channel 1627 1781 2.6e-10 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120420
AA Change: K1399R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: K1399R

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 4.5e-75 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 7.4e-43 PFAM
Pfam:Ion_trans 751 940 1.2e-45 PFAM
Pfam:Na_trans_assoc 955 1217 1.6e-72 PFAM
Pfam:Ion_trans 1243 1471 1.1e-55 PFAM
PDB:1BYY|A 1473 1525 5e-29 PDB
Pfam:Ion_trans 1564 1773 8.2e-49 PFAM
Pfam:PKD_channel 1626 1780 2.6e-9 PFAM
IQ 1902 1924 5e-2 SMART
low complexity region 1960 1982 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Scn5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Scn5a APN 9 119486224 missense probably damaging 1.00
IGL00480:Scn5a APN 9 119517538 missense possibly damaging 0.73
IGL00542:Scn5a APN 9 119492126 missense probably damaging 1.00
IGL00852:Scn5a APN 9 119537682 missense probably benign 0.26
IGL00895:Scn5a APN 9 119513104 splice site probably null
IGL00905:Scn5a APN 9 119536501 missense probably damaging 1.00
IGL01347:Scn5a APN 9 119562441 nonsense probably null
IGL01396:Scn5a APN 9 119534704 missense probably damaging 0.98
IGL01402:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01404:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01487:Scn5a APN 9 119562623 start codon destroyed probably null 0.90
IGL01612:Scn5a APN 9 119486025 missense possibly damaging 0.86
IGL02134:Scn5a APN 9 119485892 missense probably damaging 0.98
IGL02434:Scn5a APN 9 119533793 missense possibly damaging 0.83
IGL02698:Scn5a APN 9 119521097 missense probably damaging 1.00
IGL02717:Scn5a APN 9 119529010 missense probably benign 0.12
IGL02746:Scn5a APN 9 119550637 missense probably damaging 1.00
IGL02951:Scn5a APN 9 119495685 missense probably damaging 1.00
IGL03155:Scn5a APN 9 119512182 missense possibly damaging 0.74
IGL03188:Scn5a APN 9 119522566 missense probably damaging 1.00
IGL03268:Scn5a APN 9 119521231 missense probably damaging 1.00
IGL03287:Scn5a APN 9 119489778 missense probably damaging 1.00
IGL03328:Scn5a APN 9 119537636 missense probably benign 0.12
PIT4142001:Scn5a UTSW 9 119486258 missense probably damaging 1.00
R0026:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0267:Scn5a UTSW 9 119543135 missense probably damaging 0.98
R0313:Scn5a UTSW 9 119534571 missense probably damaging 1.00
R0360:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0364:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0369:Scn5a UTSW 9 119533772 missense probably damaging 0.99
R0512:Scn5a UTSW 9 119550658 missense probably damaging 1.00
R0681:Scn5a UTSW 9 119539640 missense probably damaging 0.96
R1163:Scn5a UTSW 9 119533927 missense probably damaging 1.00
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1532:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R1544:Scn5a UTSW 9 119486633 missense probably damaging 1.00
R1588:Scn5a UTSW 9 119521301 missense probably damaging 1.00
R1597:Scn5a UTSW 9 119562497 missense probably damaging 0.99
R1607:Scn5a UTSW 9 119486092 missense probably damaging 1.00
R1657:Scn5a UTSW 9 119562380 missense probably damaging 1.00
R1664:Scn5a UTSW 9 119521177 missense possibly damaging 0.84
R1785:Scn5a UTSW 9 119521129 missense probably damaging 1.00
R1925:Scn5a UTSW 9 119529019 missense probably benign
R1956:Scn5a UTSW 9 119517413 missense possibly damaging 0.82
R2006:Scn5a UTSW 9 119536480 missense probably damaging 1.00
R2061:Scn5a UTSW 9 119485651 missense probably damaging 0.98
R2083:Scn5a UTSW 9 119492123 missense probably benign 0.45
R2180:Scn5a UTSW 9 119516051 missense probably benign
R2216:Scn5a UTSW 9 119485612 missense probably benign 0.37
R2216:Scn5a UTSW 9 119513085 missense probably benign
R2320:Scn5a UTSW 9 119529956 critical splice donor site probably null
R2377:Scn5a UTSW 9 119539727 missense probably damaging 1.00
R2510:Scn5a UTSW 9 119533685 missense probably benign 0.05
R3113:Scn5a UTSW 9 119485672 missense probably damaging 1.00
R3769:Scn5a UTSW 9 119552076 critical splice acceptor site probably benign
R4133:Scn5a UTSW 9 119486372 missense probably damaging 1.00
R4164:Scn5a UTSW 9 119495778 missense probably damaging 1.00
R4447:Scn5a UTSW 9 119550627 missense probably damaging 1.00
R4635:Scn5a UTSW 9 119528985 missense possibly damaging 0.47
R4734:Scn5a UTSW 9 119539538 missense probably damaging 0.98
R4829:Scn5a UTSW 9 119534707 missense probably benign 0.00
R4867:Scn5a UTSW 9 119550671 nonsense probably null
R5055:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R5229:Scn5a UTSW 9 119535976 missense probably damaging 1.00
R5344:Scn5a UTSW 9 119534007 missense probably benign 0.25
R5424:Scn5a UTSW 9 119501734 missense probably damaging 1.00
R5517:Scn5a UTSW 9 119495713 missense probably damaging 1.00
R5526:Scn5a UTSW 9 119521171 missense probably damaging 1.00
R5560:Scn5a UTSW 9 119560286 missense probably damaging 1.00
R5719:Scn5a UTSW 9 119530052 missense possibly damaging 0.91
R5726:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R5800:Scn5a UTSW 9 119501666 missense probably damaging 1.00
R5826:Scn5a UTSW 9 119521333 missense probably damaging 1.00
R6046:Scn5a UTSW 9 119562374 missense probably damaging 1.00
R6101:Scn5a UTSW 9 119522650 missense probably damaging 0.98
R6162:Scn5a UTSW 9 119522555 missense probably damaging 0.98
R6375:Scn5a UTSW 9 119543356 missense probably damaging 1.00
R6378:Scn5a UTSW 9 119486036 missense probably damaging 1.00
R6464:Scn5a UTSW 9 119534580 missense probably damaging 1.00
R6794:Scn5a UTSW 9 119535889 missense probably damaging 0.98
R6799:Scn5a UTSW 9 119495622 missense possibly damaging 0.62
R6850:Scn5a UTSW 9 119501749 missense possibly damaging 0.92
R6858:Scn5a UTSW 9 119492090 missense probably benign 0.11
R6861:Scn5a UTSW 9 119530023 missense probably damaging 1.00
R6875:Scn5a UTSW 9 119486644 missense probably damaging 1.00
R6989:Scn5a UTSW 9 119486329 missense probably damaging 1.00
R7009:Scn5a UTSW 9 119485930 missense probably damaging 1.00
R7064:Scn5a UTSW 9 119489911 missense probably damaging 0.99
R7145:Scn5a UTSW 9 119486371 missense not run
X0023:Scn5a UTSW 9 119517769 missense probably damaging 1.00
X0065:Scn5a UTSW 9 119485669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTGGTCCTATCTCATGCTGC -3'
(R):5'- GAACTAAGTCTCCTTCTGCCCACAC -3'

Sequencing Primer
(F):5'- CCTGGACGATGTGTCCAATC -3'
(R):5'- CACACAGGTGGTGGTCAAC -3'
Posted On2014-04-13