Incidental Mutation 'R1509:Hspg2'
ID168123
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Nameperlecan (heparan sulfate proteoglycan 2)
SynonymsPlc, Pcn, per
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137468769-137570630 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 137511241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
Predicted Effect probably benign
Transcript: ENSMUST00000030547
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171332
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137528820 missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137539195 missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137562201 missense probably benign 0.15
IGL00970:Hspg2 APN 4 137542590 missense probably benign 0.09
IGL01011:Hspg2 APN 4 137559335 missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137546658 missense probably benign 0.11
IGL01333:Hspg2 APN 4 137540314 missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137538489 missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137553817 missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137519706 missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137539183 missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137552803 missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137514773 missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137564926 missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137512671 missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137561926 missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137540073 missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137552254 missense probably benign
IGL02051:Hspg2 APN 4 137568389 unclassified probably benign
IGL02124:Hspg2 APN 4 137518814 splice site probably null
IGL02128:Hspg2 APN 4 137564016 missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137515316 missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137518645 missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137510577 missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137508389 missense probably benign 0.03
IGL02477:Hspg2 APN 4 137544512 splice site probably benign
IGL02514:Hspg2 APN 4 137569576 missense probably benign 0.09
IGL02613:Hspg2 APN 4 137544420 missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137512642 missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137551848 missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137557445 splice site probably benign
IGL02701:Hspg2 APN 4 137557174 missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137555130 missense probably benign 0.00
IGL02985:Hspg2 APN 4 137507803 missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137561825 critical splice donor site probably null
IGL03181:Hspg2 APN 4 137515937 missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137560522 splice site probably benign
PIT4305001:Hspg2 UTSW 4 137550373 missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137519931 missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137542849 missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137562201 missense probably benign 0.15
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137511158 missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137515423 missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137533529 missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137550024 missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137502294 missense probably benign
R0599:Hspg2 UTSW 4 137512401 missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137553280 missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137512349 missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137541440 missense probably benign 0.00
R1403:Hspg2 UTSW 4 137540100 missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137517636 missense probably benign
R1497:Hspg2 UTSW 4 137548096 missense probably damaging 0.98
R1625:Hspg2 UTSW 4 137518971 missense probably benign 0.23
R1630:Hspg2 UTSW 4 137518435 missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137533437 nonsense probably null
R1699:Hspg2 UTSW 4 137548012 splice site probably null
R1703:Hspg2 UTSW 4 137559151 missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137514673 missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137520156 missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137518509 missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137545567 missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137565490 missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137542552 missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137564895 missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137568366 missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137559367 missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137520109 missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137517604 missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137522043 missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137549574 missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137555290 missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137565504 splice site probably benign
R3873:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137559314 missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137556657 missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137468911 missense probably benign 0.17
R4355:Hspg2 UTSW 4 137529418 missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4411:Hspg2 UTSW 4 137562224 missense probably benign
R4421:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4592:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137539575 missense possibly damaging 0.80
R4619:Hspg2 UTSW 4 137546573 missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137533730 missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137539645 missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137522127 missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137570073 unclassified probably benign
R4793:Hspg2 UTSW 4 137529473 missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137565395 missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137541666 missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137542530 missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137508031 missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137511926 missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137543914 missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137528794 splice site probably null
R5529:Hspg2 UTSW 4 137551828 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137520551 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137542825 missense probably benign 0.17
R5546:Hspg2 UTSW 4 137548174 critical splice donor site probably null
R5728:Hspg2 UTSW 4 137542766 missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137561721 missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137553782 missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137540735 missense probably benign
R6164:Hspg2 UTSW 4 137514655 missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137569518 missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137540248 missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137519686 missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137544705 missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137561955 missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137541695 missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137539396 missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137507801 missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137555275 missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137565737 missense probably benign 0.18
R6724:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137551803 missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137508398 missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137540720 missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137519289 missense probably benign 0.45
R6968:Hspg2 UTSW 4 137535156 missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137528890 missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137542269 missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137544366 missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137510652 missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137552116 missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137514719 missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137533561 critical splice donor site probably null
R7238:Hspg2 UTSW 4 137508393 missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137519946 missense probably benign 0.15
R7278:Hspg2 UTSW 4 137551125 missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137529556 missense probably benign 0.00
R7390:Hspg2 UTSW 4 137539179 missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137515664 missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137539403 missense probably benign 0.17
R7516:Hspg2 UTSW 4 137542620 missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137541440 missense possibly damaging 0.51
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137550391 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCATGGACCTCAGTTTCTGTTAC -3'
(R):5'- TGGCTCGCACATCAGTCTAGGATAC -3'

Sequencing Primer
(F):5'- GTTACCCAGTGTTCCTGGGC -3'
(R):5'- CAGGGTCCCTTACTAAGCAG -3'
Posted On2014-04-13