Incidental Mutation 'R1509:Smc6'
ID168163
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11279733 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 164 (S164N)
Ref Sequence ENSEMBL: ENSMUSP00000151976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000217906] [ENSMUST00000218022] [ENSMUST00000218866] [ENSMUST00000219776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020931
AA Change: S164N

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608
AA Change: S164N

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217906
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect possibly damaging
Transcript: ENSMUST00000218866
AA Change: S164N

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219776
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11309300 missense probably damaging 1.00
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCAGAAGCGTTAGGCGGATAGC -3'
(R):5'- AAAGCCCACTCGCAGTAACTGTGC -3'

Sequencing Primer
(F):5'- CGTTAGGCGGATAGCTTAGGG -3'
(R):5'- CTGTTAAACATGATGCTTGCTGAC -3'
Posted On2014-04-13