Incidental Mutation 'R3967:Smc6'
ID312410
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11298326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 742 (V742A)
Ref Sequence ENSEMBL: ENSMUSP00000020931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000218022]
Predicted Effect probably benign
Transcript: ENSMUST00000020931
AA Change: V742A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608
AA Change: V742A

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184262
Predicted Effect probably benign
Transcript: ENSMUST00000217930
Predicted Effect probably benign
Transcript: ENSMUST00000217991
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220289
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CATCGCATGCTGCTGTATTG -3'
(R):5'- AACATTTACCTTACGTGGTACAAGG -3'

Sequencing Primer
(F):5'- CATGCTGCTGTATTGTATGCATAG -3'
(R):5'- AGAATTTCAAAGGCCATACTTCAGG -3'
Posted On2015-04-29