Incidental Mutation 'R1513:Rag1'
ID168478
Institutional Source Beutler Lab
Gene Symbol Rag1
Ensembl Gene ENSMUSG00000061311
Gene Namerecombination activating gene 1
SynonymsRag-1
MMRRC Submission 039560-MU
Accession Numbers

MGI:97848

Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R1513 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101638282-101649501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101642991 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 602 (M602T)
Ref Sequence ENSEMBL: ENSMUSP00000077584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078494] [ENSMUST00000160037] [ENSMUST00000160722]
PDB Structure
RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078494
AA Change: M602T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077584
Gene: ENSMUSG00000061311
AA Change: M602T

DomainStartEndE-ValueType
Pfam:RAG1_imp_bd 11 288 5.7e-120 PFAM
RING 290 328 1.39e-3 SMART
ZnF_C2H2 353 376 2.61e1 SMART
PDB:3GNB|A 389 464 3e-44 PDB
ZnF_C2H2 725 750 7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(10) Chemically induced(3)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cad A G 5: 31,068,762 Y1102C probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Kif21b T C 1: 136,156,111 Y699H probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Mypn T A 10: 63,169,368 N320I probably damaging Het
Naip5 A T 13: 100,222,206 W841R probably benign Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pdzd2 G T 15: 12,373,829 S2073R possibly damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Xpo5 T A 17: 46,226,980 M611K probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Rag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rag1 APN 2 101642388 missense probably damaging 1.00
IGL01125:Rag1 APN 2 101642001 missense probably damaging 0.99
IGL01836:Rag1 APN 2 101641894 missense probably damaging 1.00
IGL02216:Rag1 APN 2 101643381 missense possibly damaging 0.91
IGL02271:Rag1 APN 2 101643388 missense probably damaging 0.99
IGL02293:Rag1 APN 2 101643046 missense probably benign 0.39
IGL02601:Rag1 APN 2 101642673 missense probably damaging 1.00
dysfunctional UTSW 2 101644284 missense probably damaging 1.00
huckle UTSW 2 101641223 intron probably benign
maladaptive UTSW 2 101645647 intron probably benign
R0658:Rag1 UTSW 2 101642683 missense probably damaging 0.99
R1126:Rag1 UTSW 2 101642689 missense probably damaging 1.00
R1177:Rag1 UTSW 2 101642278 missense probably benign 0.10
R1319:Rag1 UTSW 2 101643192 missense probably damaging 1.00
R1859:Rag1 UTSW 2 101644062 missense probably benign 0.03
R2218:Rag1 UTSW 2 101644146 missense probably benign
R3932:Rag1 UTSW 2 101643039 missense probably damaging 1.00
R4127:Rag1 UTSW 2 101642071 missense probably damaging 1.00
R4365:Rag1 UTSW 2 101642943 missense probably damaging 1.00
R4620:Rag1 UTSW 2 101643680 missense probably damaging 1.00
R4815:Rag1 UTSW 2 101643516 missense probably damaging 0.99
R5070:Rag1 UTSW 2 101642311 missense probably damaging 1.00
R5209:Rag1 UTSW 2 101644215 missense probably benign 0.01
R5239:Rag1 UTSW 2 101642955 missense possibly damaging 0.91
R5390:Rag1 UTSW 2 101642734 missense probably benign
R5607:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R6259:Rag1 UTSW 2 101644452 missense possibly damaging 0.83
R6412:Rag1 UTSW 2 101642520 missense probably damaging 0.99
R6633:Rag1 UTSW 2 101642710 missense probably damaging 1.00
R6679:Rag1 UTSW 2 101644284 missense probably damaging 1.00
R6723:Rag1 UTSW 2 101643645 missense probably damaging 0.99
R6853:Rag1 UTSW 2 101642221 missense probably damaging 0.99
R6867:Rag1 UTSW 2 101641947 missense probably damaging 1.00
R6974:Rag1 UTSW 2 101641792 missense probably damaging 0.99
X0018:Rag1 UTSW 2 101643597 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101644547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCAGACTCATCTGCCAGCATAAG -3'
(R):5'- AAGTCCTTCTGCCAGGCTACCATC -3'

Sequencing Primer
(F):5'- GCATAAGACACAACGGCTTG -3'
(R):5'- GAATGTGTCCTCCAGAACTGATG -3'
Posted On2014-04-13