Incidental Mutation 'R1500:2610507B11Rik'
ID169197
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission 039551-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1500 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78284132 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1698 (Q1698K)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010421
AA Change: Q1698K

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: Q1698K

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147432
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcg1 A G 17: 31,111,279 D518G probably benign Het
Acaca T A 11: 84,293,984 D96E probably benign Het
Actbl2 G A 13: 111,255,320 R63Q probably damaging Het
Adamts6 T A 13: 104,312,881 H266Q probably damaging Het
Aff4 T C 11: 53,372,378 V75A probably benign Het
Ank2 A G 3: 126,932,982 S888P probably benign Het
Ano7 T C 1: 93,397,328 F534S probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Bcam T A 7: 19,758,964 D484V possibly damaging Het
Ccdc88a T C 11: 29,482,713 Y1240H probably benign Het
Cfh T C 1: 140,100,876 Y500C probably damaging Het
Chd1l G A 3: 97,582,805 A478V probably benign Het
Dnah1 T C 14: 31,316,758 D122G probably benign Het
Dnah11 A T 12: 118,012,829 probably null Het
Dnah17 T C 11: 118,101,053 K1230E probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E330020D12Rik A T 1: 153,408,379 noncoding transcript Het
Ece2 T C 16: 20,644,242 L639P probably damaging Het
Epha3 A T 16: 63,595,662 V658E probably benign Het
Erbb2 C T 11: 98,428,978 T632I probably damaging Het
Erc2 A G 14: 28,271,660 T883A probably damaging Het
Extl2 T C 3: 116,027,140 V198A probably benign Het
Fktn G T 4: 53,735,065 M234I probably benign Het
Ggt7 A G 2: 155,499,046 S400P probably benign Het
Gldc A C 19: 30,113,825 V790G possibly damaging Het
Gm14496 A C 2: 181,991,233 Q3P probably benign Het
H2-D1 G A 17: 35,263,588 E95K probably benign Het
Ikzf3 T C 11: 98,518,695 E14G probably benign Het
Jag1 A T 2: 137,115,638 N51K possibly damaging Het
Khdrbs3 A G 15: 68,928,786 D14G possibly damaging Het
Krt84 A G 15: 101,530,224 V276A probably damaging Het
Lamb1 T C 12: 31,298,949 I660T possibly damaging Het
Lcmt2 A T 2: 121,140,007 S198R probably benign Het
Lcn6 G A 2: 25,677,119 R44H probably benign Het
Lrfn5 A T 12: 61,839,741 H105L probably damaging Het
Lrit1 G A 14: 37,062,134 R473K probably benign Het
March1 A G 8: 66,468,390 T495A probably damaging Het
Marveld3 T G 8: 109,948,542 probably null Het
Mbd3 T C 10: 80,394,586 D160G possibly damaging Het
Mrc2 T G 11: 105,347,725 C1233G probably damaging Het
Ms4a13 T G 19: 11,183,861 T105P probably damaging Het
Mtbp T C 15: 55,617,555 Y306H probably damaging Het
Muc3a T C 5: 137,210,501 probably benign Het
Myo1g T A 11: 6,520,811 Y15F probably benign Het
Nae1 A T 8: 104,523,584 Y226N probably benign Het
Nlrp9a A G 7: 26,567,891 S715G probably benign Het
Olfr1193 T A 2: 88,677,875 S7T possibly damaging Het
Olfr338 A T 2: 36,377,621 M282L probably benign Het
Olfr699 T C 7: 106,790,821 Y60C probably damaging Het
Olfr844 A T 9: 19,319,316 S267C probably damaging Het
Olfr972 G T 9: 39,873,411 M45I probably benign Het
Pex5l T C 3: 33,014,980 T123A probably damaging Het
Pip5kl1 A T 2: 32,576,679 N62I probably benign Het
Pkhd1l1 T C 15: 44,545,494 V2459A probably damaging Het
Prb1 T A 6: 132,207,476 Q398L unknown Het
Prkab2 T C 3: 97,663,947 L165S probably damaging Het
Prl3d2 C G 13: 27,121,706 probably benign Het
Ptdss1 G A 13: 66,995,408 G435D probably benign Het
Qrfpr A G 3: 36,182,580 L224P probably damaging Het
Rasl2-9 C T 7: 5,125,442 W163* probably null Het
Rgs5 A G 1: 169,690,414 probably null Het
Rnf19b T C 4: 129,078,961 L255P probably damaging Het
Rp9 A C 9: 22,457,455 N69K probably damaging Het
Sh3bp4 G T 1: 89,145,488 S686I probably damaging Het
Spp2 C A 1: 88,412,293 Q5K possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Syncrip A C 9: 88,479,896 S55R probably damaging Het
Tacc3 T C 5: 33,661,308 L29P probably damaging Het
Tex15 A G 8: 33,575,092 T1517A probably damaging Het
Tmem140 A G 6: 34,872,725 M59V probably benign Het
Ttn G T 2: 76,745,528 A25007E probably damaging Het
Ubr2 T C 17: 46,986,689 T253A possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usp38 A G 8: 80,995,770 L374P probably damaging Het
Vmn1r42 T A 6: 89,845,501 I29L probably benign Het
Vmn2r94 C T 17: 18,256,980 V390M probably benign Het
Vmp1 A G 11: 86,661,200 Y113H possibly damaging Het
Wdr20 T C 12: 110,794,030 M450T probably benign Het
Ylpm1 T C 12: 85,014,996 V557A unknown Het
Zpld1 T C 16: 55,233,572 N286D probably damaging Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACACCTGGTCCCAATTTATCTGTC -3'
(R):5'- CAATAGCGCACAGGAACCCCTTTAAT -3'

Sequencing Primer
(F):5'- ttccaaccactgagccac -3'
(R):5'- CCATGCAGGAAATAACTACTTTCAC -3'
Posted On2014-04-13