Incidental Mutation 'R1573:Olfr402'
ID170980
Institutional Source Beutler Lab
Gene Symbol Olfr402
Ensembl Gene ENSMUSG00000070379
Gene Nameolfactory receptor 402
SynonymsMOR255-4, GA_x6K02T2P1NL-4307199-4308146
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1573 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74153529-74158161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74155370 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 72 (M72K)
Ref Sequence ENSEMBL: ENSMUSP00000151050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073675] [ENSMUST00000216722]
Predicted Effect probably benign
Transcript: ENSMUST00000073675
AA Change: M72K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073356
Gene: ENSMUSG00000070379
AA Change: M72K

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 210 2.2e-6 PFAM
Pfam:7tm_1 44 293 9.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216722
AA Change: M72K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Olfr402
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Olfr402 APN 11 74155453 missense probably damaging 1.00
IGL03085:Olfr402 APN 11 74155685 missense probably damaging 1.00
IGL03192:Olfr402 APN 11 74155250 missense probably benign 0.13
IGL03230:Olfr402 APN 11 74155273 missense probably benign
R1478:Olfr402 UTSW 11 74155137 splice site probably null
R1728:Olfr402 UTSW 11 74155976 missense probably damaging 0.99
R1912:Olfr402 UTSW 11 74155885 missense probably damaging 1.00
R2030:Olfr402 UTSW 11 74155943 missense possibly damaging 0.94
R3151:Olfr402 UTSW 11 74155640 missense probably damaging 0.99
R4428:Olfr402 UTSW 11 74155199 missense probably damaging 1.00
R4796:Olfr402 UTSW 11 74155591 missense probably benign 0.02
R4974:Olfr402 UTSW 11 74155919 missense probably benign 0.42
R4996:Olfr402 UTSW 11 74155331 missense probably damaging 1.00
R5308:Olfr402 UTSW 11 74155571 missense probably damaging 0.99
R5912:Olfr402 UTSW 11 74155220 missense possibly damaging 0.64
R6083:Olfr402 UTSW 11 74155570 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTCAAGCACTCCCAGTTCCTTTAAC -3'
(R):5'- AGGACATAGCCACCAAGATCCTCTG -3'

Sequencing Primer
(F):5'- CCAATTCACTGAGAGGTCCTGTG -3'
(R):5'- ATTCGGGTGCTGTAAGTGAG -3'
Posted On2014-04-13