Incidental Mutation 'R1573:Mrc2'
ID170982
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1573 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105336656 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 572 (Y572N)
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably damaging
Transcript: ENSMUST00000021038
AA Change: Y572N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: Y572N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100335
AA Change: Y572N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: Y572N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151135
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTCACCATCACCAACAGGTAGAG -3'
(R):5'- TGCTTCAAGGCCAGTCAAACAGGG -3'

Sequencing Primer
(F):5'- GGATGATATCCTGGCATCCTGC -3'
(R):5'- GGTGTTAAGGGCTCACCAG -3'
Posted On2014-04-13