Incidental Mutation 'R1616:Hipk3'
ID174224
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Namehomeodomain interacting protein kinase 3
SynonymsDYRK6, FIST3
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104426481-104494446 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 104433745 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 824 (Q824*)
Ref Sequence ENSEMBL: ENSMUSP00000106754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
Predicted Effect probably null
Transcript: ENSMUST00000028600
AA Change: Q803*
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: Q803*

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111124
AA Change: Q803*
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: Q803*

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111125
AA Change: Q824*
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: Q824*

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132622
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104430231 missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104433172 missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104437089 missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104471853 splice site probably benign
IGL01932:Hipk3 APN 2 104470981 missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104431379 missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104471331 missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104471412 missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104471259 missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104433741 missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104439293 missense probably benign 0.02
R0277:Hipk3 UTSW 2 104441248 missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104433207 missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104431249 nonsense probably null
R0597:Hipk3 UTSW 2 104433637 missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104471698 missense probably benign 0.00
R1171:Hipk3 UTSW 2 104471676 missense probably benign 0.02
R1244:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104441262 missense probably benign 0.01
R1893:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104430188 missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104433841 missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104471173 missense probably benign 0.00
R1985:Hipk3 UTSW 2 104434435 missense probably benign 0.16
R2105:Hipk3 UTSW 2 104439392 missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104471485 missense probably benign 0.01
R3028:Hipk3 UTSW 2 104433790 missense probably benign
R3747:Hipk3 UTSW 2 104441283 nonsense probably null
R3923:Hipk3 UTSW 2 104470762 missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104441277 missense probably benign 0.01
R4604:Hipk3 UTSW 2 104439329 missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104433759 missense probably benign 0.00
R5193:Hipk3 UTSW 2 104430000 missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104434953 missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104440224 missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104471808 missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104471184 missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104437983 missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104471425 missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104439408 missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
X0021:Hipk3 UTSW 2 104441366 critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104434629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGAATCAGCTACTCCCAGCC -3'
(R):5'- GCAGACTACAGCAGTGTTCCAGAG -3'

Sequencing Primer
(F):5'- ATTATATCTACTCCAGGGACACTGC -3'
(R):5'- AGTGTTCCAGAGAGCACATTC -3'
Posted On2014-04-24