Incidental Mutation 'R1609:Ccdc6'
ID176685
Institutional Source Beutler Lab
Gene Symbol Ccdc6
Ensembl Gene ENSMUSG00000048701
Gene Namecoiled-coil domain containing 6
Synonyms
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70097121-70193200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70167047 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 203 (Q203K)
Ref Sequence ENSEMBL: ENSMUSP00000123374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147545]
Predicted Effect probably damaging
Transcript: ENSMUST00000147545
AA Change: Q203K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123374
Gene: ENSMUSG00000048701
AA Change: Q203K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:DUF2046 25 330 2.2e-153 PFAM
low complexity region 344 361 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
low complexity region 419 469 N/A INTRINSIC
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein is ubiquitously expressed and may function as a tumor suppressor. A chromosomal rearrangement resulting in the expression of a fusion gene containing a portion of this gene and the intracellular kinase-encoding domain of the ret proto-oncogene is the cause of thyroid papillary carcinoma.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Ccdc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Ccdc6 APN 10 70169148 missense probably benign 0.35
IGL03035:Ccdc6 APN 10 70182176 missense probably benign 0.32
R0455:Ccdc6 UTSW 10 70142571 splice site probably benign
R1102:Ccdc6 UTSW 10 70187806 missense possibly damaging 0.73
R1807:Ccdc6 UTSW 10 70175159 missense possibly damaging 0.83
R2513:Ccdc6 UTSW 10 70187828 splice site probably benign
R3933:Ccdc6 UTSW 10 70189170 unclassified probably benign
R4684:Ccdc6 UTSW 10 70189256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGCGGTAAACTTCCCGTTCTTC -3'
(R):5'- TGTTACCCAAGCTATTCAAACGCCC -3'

Sequencing Primer
(F):5'- tggagccgggatttgaac -3'
(R):5'- CCCAAAGCTATCCCTAGTTAACAG -3'
Posted On2014-04-24