Incidental Mutation 'R0091:Adcy5'
ID20243
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R0091 (G1)
Quality Score151
Status Validated (trace)
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35270998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably null
Transcript: ENSMUST00000114913
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232470
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAATGCATCTTTGACCCCTGCAC -3'
(R):5'- TGGTTAAGCTACACTCACAGCCCC -3'

Sequencing Primer
(F):5'- GTATGCCTAGCCCCTGACC -3'
(R):5'- ACTCACAGCCCCCTCCC -3'
Posted On2013-04-11