Incidental Mutation 'R1856:Pclo'
ID206109
Institutional Source Beutler Lab
Gene Symbol Pclo
Ensembl Gene ENSMUSG00000061601
Gene Namepiccolo (presynaptic cytomatrix protein)
SynonymsAcz, Pico
MMRRC Submission 039880-MU
Accession Numbers

Ncbi RefSeq: NM_011995.4; NM_001110796.1; MGI:1349390

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location14514918-14863459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 14778552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1402 (V1402F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030691] [ENSMUST00000182407]
Predicted Effect unknown
Transcript: ENSMUST00000030691
AA Change: V4674F
SMART Domains Protein: ENSMUSP00000030691
Gene: ENSMUSG00000061601
AA Change: V4674F

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.23e-13 PROSPERO
internal_repeat_2 305 389 1.23e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 530 589 5.2e-30 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 995 1053 6.7e-33 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_4 1196 1249 1.65e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_4 3473 3521 1.65e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
low complexity region 4870 4892 N/A INTRINSIC
C2 4951 5057 8.56e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182407
AA Change: V4674F
SMART Domains Protein: ENSMUSP00000138419
Gene: ENSMUSG00000061601
AA Change: V4674F

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.06e-13 PROSPERO
internal_repeat_2 305 389 1.06e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 528 589 3e-36 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 993 1053 4.3e-37 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_3 1196 1249 1.46e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_3 3473 3521 1.46e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182426
Predicted Effect probably damaging
Transcript: ENSMUST00000182915
AA Change: V1402F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198310
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype Strain: 3699630; 4442915; 4442914
Lethality: D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the presynaptic cytoskeletal matrix, which is involved in establishing active synaptic zones and in synaptic vesicle trafficking. Variations in this gene have been associated with bipolar disorder and major depressive disorder. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for one deletion of Pclo are viable and fertile, and display no overt abnormal phenotype. Mice homozygous for another knock-out allele exhibit some premature lethality, decreased body size, and abnormal synaptic vesicle number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Pclo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Pclo APN 5 14521677 nonsense probably null
IGL00429:Pclo APN 5 14680739 unclassified probably benign
IGL00498:Pclo APN 5 14540739 missense unknown
IGL00528:Pclo APN 5 14676434 unclassified probably benign
IGL00743:Pclo APN 5 14678021 unclassified probably benign
IGL00809:Pclo APN 5 14675797 missense unknown
IGL00811:Pclo APN 5 14680010 unclassified probably benign
IGL00819:Pclo APN 5 14858846 missense unknown
IGL00870:Pclo APN 5 14539983 missense unknown
IGL00925:Pclo APN 5 14766741 missense unknown
IGL00960:Pclo APN 5 14675220 missense unknown
IGL01013:Pclo APN 5 14793834 missense unknown
IGL01112:Pclo APN 5 14681069 missense unknown
IGL01124:Pclo APN 5 14714329 missense unknown
IGL01150:Pclo APN 5 14676912 unclassified probably benign
IGL01302:Pclo APN 5 14675999 unclassified probably benign
IGL01389:Pclo APN 5 14714521 missense probably damaging 0.99
IGL01448:Pclo APN 5 14676394 unclassified probably benign
IGL01449:Pclo APN 5 14678516 unclassified probably benign
IGL01450:Pclo APN 5 14677193 unclassified probably benign
IGL01476:Pclo APN 5 14521108 missense probably damaging 1.00
IGL01537:Pclo APN 5 14539633 missense unknown
IGL01568:Pclo APN 5 14678429 unclassified probably benign
IGL01574:Pclo APN 5 14713448 missense unknown
IGL01637:Pclo APN 5 14540034 missense unknown
IGL01646:Pclo APN 5 14713867 missense unknown
IGL01672:Pclo APN 5 14678535 unclassified probably benign
IGL01705:Pclo APN 5 14677865 unclassified probably benign
IGL02127:Pclo APN 5 14765145 splice site probably benign
IGL02215:Pclo APN 5 14856985 missense unknown
IGL02271:Pclo APN 5 14679494 unclassified probably benign
IGL02300:Pclo APN 5 14713741 missense unknown
IGL02346:Pclo APN 5 14677538 unclassified probably benign
IGL02449:Pclo APN 5 14515343 missense probably damaging 1.00
IGL02452:Pclo APN 5 14676966 unclassified probably benign
IGL02455:Pclo APN 5 14540175 missense unknown
IGL02478:Pclo APN 5 14766778 missense unknown
IGL02677:Pclo APN 5 14676929 unclassified probably benign
IGL02711:Pclo APN 5 14522308 missense unknown
IGL02737:Pclo APN 5 14714163 missense unknown
IGL02943:Pclo APN 5 14669221 missense unknown
IGL03184:Pclo APN 5 14714443 missense probably damaging 1.00
IGL03246:Pclo APN 5 14677617 unclassified probably benign
IGL03263:Pclo APN 5 14681810 missense unknown
IGL03300:Pclo APN 5 14712798 missense unknown
IGL03399:Pclo APN 5 14766731 missense unknown
Gauche UTSW 5 14793855 missense unknown
P0018:Pclo UTSW 5 14677721 unclassified probably benign
R0014:Pclo UTSW 5 14680451 unclassified probably benign
R0014:Pclo UTSW 5 14680451 unclassified probably benign
R0020:Pclo UTSW 5 14669673 missense unknown
R0045:Pclo UTSW 5 14539471 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0128:Pclo UTSW 5 14679797 unclassified probably benign
R0130:Pclo UTSW 5 14679797 unclassified probably benign
R0141:Pclo UTSW 5 14791922 missense unknown
R0226:Pclo UTSW 5 14765223 missense probably damaging 0.99
R0243:Pclo UTSW 5 14775420 missense unknown
R0267:Pclo UTSW 5 14681180 missense unknown
R0313:Pclo UTSW 5 14678873 unclassified probably benign
R0324:Pclo UTSW 5 14669433 missense unknown
R0331:Pclo UTSW 5 14680376 unclassified probably benign
R0370:Pclo UTSW 5 14521090 missense probably damaging 1.00
R0398:Pclo UTSW 5 14681702 missense unknown
R0401:Pclo UTSW 5 14681734 missense unknown
R0417:Pclo UTSW 5 14713022 missense unknown
R0468:Pclo UTSW 5 14677288 unclassified probably benign
R0472:Pclo UTSW 5 14681594 missense unknown
R0488:Pclo UTSW 5 14669299 missense unknown
R0511:Pclo UTSW 5 14678285 unclassified probably benign
R0511:Pclo UTSW 5 14679398 unclassified probably benign
R0520:Pclo UTSW 5 14713830 nonsense probably null
R0547:Pclo UTSW 5 14792072 missense unknown
R0611:Pclo UTSW 5 14678775 unclassified probably benign
R0611:Pclo UTSW 5 14712814 missense unknown
R0624:Pclo UTSW 5 14669656 missense unknown
R0628:Pclo UTSW 5 14669538 missense unknown
R0639:Pclo UTSW 5 14681749 nonsense probably null
R0653:Pclo UTSW 5 14682255 intron probably benign
R0681:Pclo UTSW 5 14675318 missense unknown
R0689:Pclo UTSW 5 14714019 missense unknown
R0698:Pclo UTSW 5 14712516 missense unknown
R0737:Pclo UTSW 5 14515439 missense probably damaging 1.00
R0883:Pclo UTSW 5 14677859 nonsense probably null
R0906:Pclo UTSW 5 14676686 unclassified probably benign
R1056:Pclo UTSW 5 14540055 nonsense probably null
R1107:Pclo UTSW 5 14677869 unclassified probably benign
R1174:Pclo UTSW 5 14677646 unclassified probably benign
R1184:Pclo UTSW 5 14522262 missense unknown
R1302:Pclo UTSW 5 14681633 missense unknown
R1318:Pclo UTSW 5 14679314 unclassified probably benign
R1342:Pclo UTSW 5 14682177 intron probably benign
R1378:Pclo UTSW 5 14682313 missense probably benign 0.23
R1418:Pclo UTSW 5 14678130 unclassified probably benign
R1471:Pclo UTSW 5 14680427 unclassified probably benign
R1485:Pclo UTSW 5 14713779 missense unknown
R1523:Pclo UTSW 5 14788406 missense unknown
R1527:Pclo UTSW 5 14679648 unclassified probably benign
R1531:Pclo UTSW 5 14521903 missense probably damaging 0.99
R1537:Pclo UTSW 5 14712475 missense unknown
R1574:Pclo UTSW 5 14679831 unclassified probably benign
R1574:Pclo UTSW 5 14679831 unclassified probably benign
R1581:Pclo UTSW 5 14521282 missense probably benign 0.28
R1613:Pclo UTSW 5 14679132 unclassified probably benign
R1632:Pclo UTSW 5 14680003 unclassified probably benign
R1688:Pclo UTSW 5 14788493 critical splice donor site probably null
R1694:Pclo UTSW 5 14520963 missense probably damaging 1.00
R1707:Pclo UTSW 5 14713224 missense unknown
R1727:Pclo UTSW 5 14676987 unclassified probably benign
R1741:Pclo UTSW 5 14676510 unclassified probably benign
R1853:Pclo UTSW 5 14676684 unclassified probably benign
R1907:Pclo UTSW 5 14678511 unclassified probably benign
R1970:Pclo UTSW 5 14713473 missense unknown
R1971:Pclo UTSW 5 14713473 missense unknown
R1973:Pclo UTSW 5 14676059 unclassified probably null
R1978:Pclo UTSW 5 14713795 missense unknown
R1999:Pclo UTSW 5 14677080 unclassified probably benign
R2015:Pclo UTSW 5 14521501 missense probably damaging 0.98
R2084:Pclo UTSW 5 14682148 missense probably benign 0.23
R2144:Pclo UTSW 5 14858752 missense unknown
R2155:Pclo UTSW 5 14714295 missense probably benign 0.02
R2191:Pclo UTSW 5 14713848 missense unknown
R2237:Pclo UTSW 5 14713938 missense unknown
R2276:Pclo UTSW 5 14714273 missense unknown
R2279:Pclo UTSW 5 14714273 missense unknown
R2281:Pclo UTSW 5 14540332 missense unknown
R2307:Pclo UTSW 5 14678651 unclassified probably benign
R2386:Pclo UTSW 5 14765247 missense unknown
R2407:Pclo UTSW 5 14678932 unclassified probably benign
R2512:Pclo UTSW 5 14712598 missense unknown
R2889:Pclo UTSW 5 14856981 missense unknown
R2966:Pclo UTSW 5 14681150 missense unknown
R3151:Pclo UTSW 5 14521678 missense probably damaging 0.99
R3424:Pclo UTSW 5 14680418 unclassified probably benign
R3687:Pclo UTSW 5 14668995 missense unknown
R3719:Pclo UTSW 5 14521161 missense probably benign 0.33
R3739:Pclo UTSW 5 14680899 missense unknown
R3745:Pclo UTSW 5 14678421 unclassified probably benign
R3771:Pclo UTSW 5 14539408 critical splice acceptor site probably null
R3789:Pclo UTSW 5 14680450 unclassified probably benign
R3803:Pclo UTSW 5 14515402 nonsense probably null
R3902:Pclo UTSW 5 14712522 missense probably benign 0.01
R3942:Pclo UTSW 5 14679918 unclassified probably benign
R4061:Pclo UTSW 5 14540566 missense unknown
R4094:Pclo UTSW 5 14855645 missense unknown
R4175:Pclo UTSW 5 14713875 missense probably damaging 0.99
R4195:Pclo UTSW 5 14677563 unclassified probably benign
R4398:Pclo UTSW 5 14775366 missense probably damaging 1.00
R4429:Pclo UTSW 5 14678100 unclassified probably benign
R4523:Pclo UTSW 5 14679992 unclassified probably benign
R4531:Pclo UTSW 5 14775408 missense unknown
R4552:Pclo UTSW 5 14669271 missense unknown
R4563:Pclo UTSW 5 14521369 missense probably damaging 1.00
R4581:Pclo UTSW 5 14675505 missense unknown
R4638:Pclo UTSW 5 14680433 nonsense probably null
R4655:Pclo UTSW 5 14682383 intron probably benign
R4703:Pclo UTSW 5 14676480 unclassified probably benign
R4704:Pclo UTSW 5 14676480 unclassified probably benign
R4705:Pclo UTSW 5 14676480 unclassified probably benign
R4706:Pclo UTSW 5 14714207 missense unknown
R4709:Pclo UTSW 5 14778558 missense unknown
R4755:Pclo UTSW 5 14714348 missense unknown
R4786:Pclo UTSW 5 14723267 missense unknown
R4801:Pclo UTSW 5 14675815 missense unknown
R4802:Pclo UTSW 5 14675815 missense unknown
R4812:Pclo UTSW 5 14540025 missense unknown
R4817:Pclo UTSW 5 14675031 missense unknown
R4817:Pclo UTSW 5 14713125 missense unknown
R4845:Pclo UTSW 5 14679118 unclassified probably benign
R4876:Pclo UTSW 5 14811680 missense unknown
R4907:Pclo UTSW 5 14680051 unclassified probably benign
R4943:Pclo UTSW 5 14712637 missense unknown
R4963:Pclo UTSW 5 14669221 missense unknown
R4970:Pclo UTSW 5 14677882 unclassified probably benign
R4978:Pclo UTSW 5 14714478 missense probably benign 0.23
R4982:Pclo UTSW 5 14679294 unclassified probably benign
R5019:Pclo UTSW 5 14714367 missense unknown
R5068:Pclo UTSW 5 14679073 unclassified probably benign
R5092:Pclo UTSW 5 14677308 unclassified probably benign
R5112:Pclo UTSW 5 14677882 unclassified probably benign
R5124:Pclo UTSW 5 14677392 unclassified probably benign
R5210:Pclo UTSW 5 14713450 missense probably damaging 0.99
R5227:Pclo UTSW 5 14713560 missense probably benign 0.23
R5264:Pclo UTSW 5 14676923 unclassified probably benign
R5280:Pclo UTSW 5 14540717 missense unknown
R5286:Pclo UTSW 5 14679747 unclassified probably benign
R5297:Pclo UTSW 5 14676249 unclassified probably benign
R5344:Pclo UTSW 5 14676612 unclassified probably benign
R5354:Pclo UTSW 5 14678808 unclassified probably benign
R5358:Pclo UTSW 5 14712736 nonsense probably null
R5363:Pclo UTSW 5 14669410 missense unknown
R5377:Pclo UTSW 5 14681353 missense unknown
R5457:Pclo UTSW 5 14676143 unclassified probably benign
R5468:Pclo UTSW 5 14680952 missense unknown
R5588:Pclo UTSW 5 14788398 missense unknown
R5836:Pclo UTSW 5 14678535 unclassified probably benign
R5865:Pclo UTSW 5 14714478 missense probably benign 0.23
R5875:Pclo UTSW 5 14680600 unclassified probably benign
R5892:Pclo UTSW 5 14521171 missense probably damaging 1.00
R5905:Pclo UTSW 5 14680385 unclassified probably benign
R5967:Pclo UTSW 5 14540655 missense unknown
R6046:Pclo UTSW 5 14713288 missense unknown
R6059:Pclo UTSW 5 14811700 missense unknown
R6092:Pclo UTSW 5 14677923 unclassified probably benign
R6119:Pclo UTSW 5 14677019 unclassified probably benign
R6221:Pclo UTSW 5 14675313 missense unknown
R6243:Pclo UTSW 5 14676443 unclassified probably benign
R6269:Pclo UTSW 5 14522094 nonsense probably null
R6303:Pclo UTSW 5 14677893 unclassified probably benign
R6304:Pclo UTSW 5 14677893 unclassified probably benign
R6453:Pclo UTSW 5 14676789 unclassified probably benign
R6460:Pclo UTSW 5 14679132 unclassified probably benign
R6497:Pclo UTSW 5 14793855 missense unknown
R6498:Pclo UTSW 5 14669491 missense unknown
R6524:Pclo UTSW 5 14718869 missense unknown
R6682:Pclo UTSW 5 14539879 missense unknown
R6823:Pclo UTSW 5 14677907 unclassified probably benign
R6830:Pclo UTSW 5 14681099 missense unknown
R6831:Pclo UTSW 5 14788429 nonsense probably null
R6965:Pclo UTSW 5 14681962 intron probably benign
X0058:Pclo UTSW 5 14682131 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTGTTGGATTCCTAGCCTAACATTAG -3'
(R):5'- AAGAACACTTTGCTGCAGGC -3'

Sequencing Primer
(F):5'- GCCTCAACTCAGTTGCAT -3'
(R):5'- TTGCTGCAGGCCTAATTCAACAG -3'
Posted On2014-06-23