Incidental Mutation 'R1856:Ankhd1'
ID206186
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36644527 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1588 (A1588T)
Ref Sequence ENSEMBL: ENSMUSP00000120290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably benign
Transcript: ENSMUST00000006205
AA Change: A1588T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: A1588T

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000037072
AA Change: A77T
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: A77T

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130035
SMART Domains Protein: ENSMUSP00000117110
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 2 26 5.35e2 SMART
ANK 30 59 9.41e-6 SMART
ANK 63 96 3.8e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140061
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142977
AA Change: A1588T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: A1588T

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152940
Predicted Effect probably benign
Transcript: ENSMUST00000153612
SMART Domains Protein: ENSMUSP00000116462
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 10 39 9.41e-6 SMART
ANK 43 76 3.8e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155329
AA Change: A1588T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: A1588T

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTCTGCTACATCTACCACG -3'
(R):5'- TACCGTGTCTGAGTCTTGGAAG -3'

Sequencing Primer
(F):5'- GCTACATCTACCACGTTTACAAATG -3'
(R):5'- AAGTGGTGGTAACTGCCTTTTCC -3'
Posted On2014-06-23