Incidental Mutation 'R1846:Cenpe'
ID207708
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135239845 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1040 (I1040N)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
Predicted Effect probably damaging
Transcript: ENSMUST00000062893
AA Change: I1040N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: I1040N

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Meta Mutation Damage Score 0.0344 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCCAGTGAACAGG -3'
(R):5'- AGTTCTAACTTAGGCAGAGACATCTG -3'

Sequencing Primer
(F):5'- GAACCCAAAGCTAGCTGTCTGTATG -3'
(R):5'- GACATCTGTCAAGTCATATAACCATC -3'
Posted On2014-06-23