Incidental Mutation 'R2268:Cenpe'
ID242214
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 040268-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2268 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135261636 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2180 (T2180A)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: T2180A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: T2180A

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200616
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Acox2 A T 14: 8,253,496 M217K probably damaging Het
Adam34 C T 8: 43,650,610 R666H probably benign Het
Adap2 G T 11: 80,165,726 Q188H probably damaging Het
Adgrb3 T C 1: 25,111,817 T872A possibly damaging Het
Ahnak A G 19: 9,010,574 K3074R possibly damaging Het
Ano7 A T 1: 93,380,439 D64V possibly damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Arl13a A G X: 134,205,413 Q236R possibly damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Atn1 C G 6: 124,746,240 probably benign Het
Ccser1 C T 6: 61,570,843 T118M probably damaging Het
Col17a1 G A 19: 47,650,111 P1173S probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp4f17 G T 17: 32,517,954 V87F probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dhodh A G 8: 109,594,674 F360S possibly damaging Het
Dynap C T 18: 70,241,147 A103T probably benign Het
Edem2 G A 2: 155,702,217 P538S probably benign Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Erich6 A T 3: 58,618,839 S581T probably benign Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Fzd9 A G 5: 135,250,294 S246P probably damaging Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hmcn1 A G 1: 150,624,598 probably benign Het
Hps3 G A 3: 20,012,935 probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Irs2 T C 8: 11,007,586 E282G probably damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kif14 T A 1: 136,519,748 C1430* probably null Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lamb1 A T 12: 31,327,645 I1630F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtbp G A 15: 55,569,160 probably null Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Myoc C T 1: 162,649,056 T443M probably damaging Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr906 T A 9: 38,488,208 Y60N probably damaging Het
Opcml T C 9: 28,903,355 I301T possibly damaging Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rdh7 A G 10: 127,884,661 S281P probably benign Het
Rps17 C T 7: 81,344,998 R5H probably benign Het
Scgb1b2 T A 7: 31,291,776 probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Snap23 A G 2: 120,599,312 T213A probably benign Het
Spag17 C A 3: 100,061,866 probably null Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
St8sia5 T C 18: 77,232,830 S93P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbc1d22b A G 17: 29,599,854 H394R probably damaging Het
Tbx5 A T 5: 119,845,109 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Ttc37 T G 13: 76,112,274 probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vangl1 A T 3: 102,196,844 Y7N probably damaging Het
Vav2 A T 2: 27,292,655 probably null Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r15 A G 5: 109,293,207 Y262H probably benign Het
Vmn2r76 T C 7: 86,230,499 M198V probably benign Het
Zfp831 A C 2: 174,644,241 R236S probably benign Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCATTCATTGTCTTGAGCACTG -3'
(R):5'- ACAGCGCACTCACCCTTAGT -3'

Sequencing Primer
(F):5'- TGAATTTCAGCATGCACACTC -3'
(R):5'- CCTTAGTGAGGGTTTGACTGC -3'
Posted On2014-10-16