Incidental Mutation 'R0121:Ccnh'
ID21054
Institutional Source Beutler Lab
Gene Symbol Ccnh
Ensembl Gene ENSMUSG00000021548
Gene Namecyclin H
Synonyms
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location85189408-85223469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85206193 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 252 (M252K)
Ref Sequence ENSEMBL: ENSMUSP00000022030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022030] [ENSMUST00000163600] [ENSMUST00000164127] [ENSMUST00000165077]
Predicted Effect probably damaging
Transcript: ENSMUST00000022030
AA Change: M252K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022030
Gene: ENSMUSG00000021548
AA Change: M252K

DomainStartEndE-ValueType
CYCLIN 62 152 2.1e-13 SMART
SCOP:d1jkw_2 162 287 8e-47 SMART
Blast:CYCLIN 169 237 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000163600
AA Change: M216K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129349
Gene: ENSMUSG00000021548
AA Change: M216K

DomainStartEndE-ValueType
CYCLIN 62 152 2.1e-13 SMART
SCOP:d1jkw_2 162 251 4e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163713
AA Change: M54K
SMART Domains Protein: ENSMUSP00000130820
Gene: ENSMUSG00000021548
AA Change: M54K

DomainStartEndE-ValueType
Pfam:Cyclin_C_2 1 65 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164127
AA Change: M252K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131136
Gene: ENSMUSG00000021548
AA Change: M252K

DomainStartEndE-ValueType
CYCLIN 62 152 2.1e-13 SMART
Pfam:Cyclin_C_2 162 262 3.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165077
SMART Domains Protein: ENSMUSP00000130839
Gene: ENSMUSG00000021548

DomainStartEndE-ValueType
PDB:1JKW|A 1 111 1e-72 PDB
SCOP:d1jkw_1 11 104 1e-18 SMART
Blast:CYCLIN 62 111 5e-25 BLAST
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Ccnh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Ccnh APN 13 85206151 missense probably damaging 1.00
IGL02544:Ccnh APN 13 85202341 nonsense probably null
IGL02547:Ccnh APN 13 85202504 unclassified probably benign
IGL03167:Ccnh APN 13 85197566 splice site probably benign
R1781:Ccnh UTSW 13 85206135 missense possibly damaging 0.59
R3775:Ccnh UTSW 13 85206124 unclassified probably benign
R4748:Ccnh UTSW 13 85189639 missense probably benign 0.41
R4905:Ccnh UTSW 13 85206135 missense possibly damaging 0.59
R5696:Ccnh UTSW 13 85196327 critical splice donor site probably null
R5976:Ccnh UTSW 13 85190863 missense probably damaging 1.00
R6784:Ccnh UTSW 13 85212765 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACATCTCTTAAACTGGCAGAAGTGG -3'
(R):5'- GATGCAAACTTTCCCTTGAAGTGAGC -3'

Sequencing Primer
(F):5'- GAAGTGGTAGTAAGTTTTTCAAACTC -3'
(R):5'- AGCTCTCTGATTCTAAATGTCTACC -3'
Posted On2013-04-11