Incidental Mutation 'R0126:Cdh5'
ID21374
Institutional Source Beutler Lab
Gene Symbol Cdh5
Ensembl Gene ENSMUSG00000031871
Gene Namecadherin 5
SynonymsVECD, VEcad, VE-cadherin, CD144, VE-Cad, 7B4/cadherin-5, VEC
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0126 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location104101625-104144511 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 104140682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034339]
PDB Structure
NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000034339
SMART Domains Protein: ENSMUSP00000034339
Gene: ENSMUSG00000031871

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 66 147 3.03e-10 SMART
CA 171 254 3.19e-18 SMART
CA 278 370 7.92e-14 SMART
CA 392 476 1.09e-16 SMART
CA 499 583 2.16e-6 SMART
transmembrane domain 598 620 N/A INTRINSIC
Pfam:Cadherin_C 625 776 1.1e-43 PFAM
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein die in utero due to vascular insufficiency, caused by increased endothelial apoptosis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous inactivation or cytosolic truncation of this gene causes embryonic growth retardation, abnormal somite and heart development, impaired remodeling and maturation of endothelial cells, increased endothelial apoptosis and severe vascular defects leading to embryonic death at midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Cdh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Cdh5 APN 8 104137817 missense probably damaging 1.00
IGL02506:Cdh5 APN 8 104137822 missense probably damaging 1.00
IGL02737:Cdh5 APN 8 104142928 missense probably damaging 1.00
IGL03287:Cdh5 APN 8 104128115 missense probably damaging 1.00
IGL03297:Cdh5 APN 8 104128199 missense probably damaging 1.00
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0167:Cdh5 UTSW 8 104136735 missense possibly damaging 0.51
R0592:Cdh5 UTSW 8 104130902 splice site probably null
R1760:Cdh5 UTSW 8 104128169 missense probably benign
R1826:Cdh5 UTSW 8 104131091 missense possibly damaging 0.93
R1827:Cdh5 UTSW 8 104112909 missense possibly damaging 0.96
R1840:Cdh5 UTSW 8 104126616 nonsense probably null
R1993:Cdh5 UTSW 8 104137815 missense probably damaging 0.97
R2219:Cdh5 UTSW 8 104142906 missense possibly damaging 0.94
R2239:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R2281:Cdh5 UTSW 8 104125733 missense probably damaging 1.00
R2380:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R3418:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3419:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3429:Cdh5 UTSW 8 104130968 missense possibly damaging 0.91
R4491:Cdh5 UTSW 8 104113040 missense probably damaging 1.00
R4823:Cdh5 UTSW 8 104142669 missense probably benign 0.00
R5071:Cdh5 UTSW 8 104140702 missense probably damaging 0.99
R5265:Cdh5 UTSW 8 104142739 missense probably benign 0.00
R5383:Cdh5 UTSW 8 104137847 missense probably benign 0.17
R5447:Cdh5 UTSW 8 104129362 missense probably damaging 0.99
R5580:Cdh5 UTSW 8 104125494 nonsense probably null
R5876:Cdh5 UTSW 8 104142577 missense probably damaging 1.00
R5934:Cdh5 UTSW 8 104138268 missense probably benign 0.00
R6378:Cdh5 UTSW 8 104126536 splice site probably null
R7110:Cdh5 UTSW 8 104140768 missense probably damaging 1.00
R7141:Cdh5 UTSW 8 104113001 missense probably benign 0.20
X0067:Cdh5 UTSW 8 104142537 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAAGGGGATGTGTACCCACTGAC -3'
(R):5'- CACTGACCTGTGATGGTGAGGATG -3'

Sequencing Primer
(F):5'- GTCTTACATGTTAACTGAGCCG -3'
(R):5'- TGCCATCTCCTCACAGAAGG -3'
Posted On2013-04-11