Incidental Mutation 'R0684:Pigf'
ID218639
Institutional Source Beutler Lab
Gene Symbol Pigf
Ensembl Gene ENSMUSG00000024145
Gene Namephosphatidylinositol glycan anchor biosynthesis, class F
Synonyms
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0684 (G1)
Quality Score80
Status Validated
Chromosome17
Chromosomal Location86997256-87025406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87020495 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 115 (F115I)
Ref Sequence ENSEMBL: ENSMUSP00000024957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024957]
Predicted Effect probably benign
Transcript: ENSMUST00000024957
AA Change: F115I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024957
Gene: ENSMUSG00000024145
AA Change: F115I

DomainStartEndE-ValueType
Pfam:PIG-F 21 204 1.6e-50 PFAM
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor, a glycolipid containing three mannose molecules in its core backbone, is found on many blood cells where it serves to anchor proteins to the cell surface. The encoded protein and another GPI synthesis protein, PIGO, function in the transfer of ethanolaminephosphate to the third mannose in GPI. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Pigf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pigf APN 17 87020448 missense probably null 0.41
IGL01484:Pigf APN 17 87008880 missense probably benign 0.04
R0506:Pigf UTSW 17 87008909 missense probably benign 0.00
R0987:Pigf UTSW 17 86997545 missense probably damaging 1.00
R4295:Pigf UTSW 17 87023756 missense probably benign 0.00
R5365:Pigf UTSW 17 87023708 missense possibly damaging 0.62
R6287:Pigf UTSW 17 86997539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTGCCTAGAAACGCTCATAG -3'
(R):5'- GCAGAGCAGGAAAGTCTTGTCTTGG -3'

Sequencing Primer
(F):5'- CGCTCATAGGATGAGTATATTGACAC -3'
(R):5'- TGTGTATGTGCACCGCTAAG -3'
Posted On2014-08-18