Incidental Mutation 'R0684:Bcl2l12'
ID61070
Institutional Source Beutler Lab
Gene Symbol Bcl2l12
Ensembl Gene ENSMUSG00000003190
Gene NameBCL2-like 12 (proline rich)
Synonyms2810475P17Rik, Bcl-L12, Bcl2-L12, 5430429M05Rik
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0684 (G1)
Quality Score164
Status Validated
Chromosome7
Chromosomal Location44991222-44998712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44996601 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 65 (T65S)
Ref Sequence ENSEMBL: ENSMUSP00000146945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003284] [ENSMUST00000003290] [ENSMUST00000107834] [ENSMUST00000207128] [ENSMUST00000207342] [ENSMUST00000207443] [ENSMUST00000207521] [ENSMUST00000207755] [ENSMUST00000209066]
Predicted Effect probably benign
Transcript: ENSMUST00000003284
SMART Domains Protein: ENSMUSP00000003284
Gene: ENSMUSG00000003184

DomainStartEndE-ValueType
IRF 1 112 6.92e-50 SMART
IRF-3 195 373 4.87e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000003290
AA Change: T65S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003290
Gene: ENSMUSG00000003190
AA Change: T65S

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 170 197 N/A INTRINSIC
SCOP:d1maz__ 227 243 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107834
SMART Domains Protein: ENSMUSP00000103465
Gene: ENSMUSG00000003184

DomainStartEndE-ValueType
IRF 1 112 6.92e-50 SMART
IRF-3 195 373 4.87e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152595
Predicted Effect probably benign
Transcript: ENSMUST00000207128
Predicted Effect probably benign
Transcript: ENSMUST00000207129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207213
Predicted Effect probably benign
Transcript: ENSMUST00000207342
AA Change: T65S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207443
AA Change: T65S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207476
Predicted Effect probably benign
Transcript: ENSMUST00000207521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207555
Predicted Effect probably benign
Transcript: ENSMUST00000207755
AA Change: T65S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208906
Predicted Effect probably benign
Transcript: ENSMUST00000208958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209006
Predicted Effect probably benign
Transcript: ENSMUST00000209066
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins containing a Bcl-2 homology domain 2 (BH2). The encoded protein is an anti-apoptotic factor that acts as an inhibitor of caspases 3 and 7 in the cytoplasm. In the nucleus, it binds to the p53 tumor suppressor protein, preventing its association with target genes. Overexpression of this gene has been detected in a number of different cancers. There is a pseudogene for this gene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Bcl2l12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Bcl2l12 APN 7 44996893 missense possibly damaging 0.46
IGL02675:Bcl2l12 APN 7 44991400 unclassified probably benign
R1548:Bcl2l12 UTSW 7 44992818 missense probably damaging 1.00
R4612:Bcl2l12 UTSW 7 44996585 missense probably damaging 1.00
R4995:Bcl2l12 UTSW 7 44994191 splice site probably null
R5171:Bcl2l12 UTSW 7 44991394 unclassified probably benign
R5910:Bcl2l12 UTSW 7 44996543 critical splice donor site probably null
R5918:Bcl2l12 UTSW 7 44991464 unclassified probably benign
R7112:Bcl2l12 UTSW 7 44996914 missense probably damaging 1.00
R7471:Bcl2l12 UTSW 7 44996553 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGCTGAAGCTGAACCGTGTTG -3'
(R):5'- CTTCCTGAGTCTTGTGGTCCAAACC -3'

Sequencing Primer
(F):5'- GCTGAACCGTGTTGACTTTATAATG -3'
(R):5'- AGACCTAACTCCATGTGCCTG -3'
Posted On2013-07-30