Incidental Mutation 'R1971:Bpifb5'
ID220803
Institutional Source Beutler Lab
Gene Symbol Bpifb5
Ensembl Gene ENSMUSG00000038572
Gene NameBPI fold containing family B, member 5
SynonymsBC018465
MMRRC Submission 039984-MU
Accession Numbers

Genbank: NM_144890; MGI: 2385160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154223742-154240902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154230344 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 324 (Q324K)
Ref Sequence ENSEMBL: ENSMUSP00000046683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045959]
Predicted Effect probably benign
Transcript: ENSMUST00000045959
AA Change: Q324K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046683
Gene: ENSMUSG00000038572
AA Change: Q324K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
coiled coil region 26 54 N/A INTRINSIC
Pfam:LBP_BPI_CETP 94 231 7.6e-14 PFAM
Blast:BPI2 291 488 4e-91 BLAST
SCOP:d1ewfa2 433 486 8e-3 SMART
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Bpifb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Bpifb5 APN 2 154233249 missense possibly damaging 0.86
IGL01676:Bpifb5 APN 2 154229049 missense possibly damaging 0.71
IGL02065:Bpifb5 APN 2 154227183 missense probably damaging 0.98
IGL02141:Bpifb5 APN 2 154229557 splice site probably null
IGL02244:Bpifb5 APN 2 154225148 missense possibly damaging 0.93
IGL03118:Bpifb5 APN 2 154236753 splice site probably benign
A4554:Bpifb5 UTSW 2 154227180 missense possibly damaging 0.71
R0022:Bpifb5 UTSW 2 154230348 missense probably damaging 0.98
R0492:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0654:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0692:Bpifb5 UTSW 2 154234696 missense probably benign 0.33
R0707:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0898:Bpifb5 UTSW 2 154233334 missense probably benign
R1534:Bpifb5 UTSW 2 154229499 missense possibly damaging 0.86
R1539:Bpifb5 UTSW 2 154223856 missense probably benign
R1874:Bpifb5 UTSW 2 154227202 splice site probably benign
R2001:Bpifb5 UTSW 2 154233279 missense possibly damaging 0.53
R3013:Bpifb5 UTSW 2 154228855 missense possibly damaging 0.59
R3916:Bpifb5 UTSW 2 154228181 missense probably benign
R4499:Bpifb5 UTSW 2 154240758 missense possibly damaging 0.53
R5250:Bpifb5 UTSW 2 154224961 missense probably benign
R6301:Bpifb5 UTSW 2 154230219 missense possibly damaging 0.73
R6836:Bpifb5 UTSW 2 154228065 missense probably benign 0.02
R6869:Bpifb5 UTSW 2 154233223 missense probably benign 0.33
R7014:Bpifb5 UTSW 2 154224956 nonsense probably null
R7300:Bpifb5 UTSW 2 154228146 missense possibly damaging 0.85
T0975:Bpifb5 UTSW 2 154229464 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGCTATCCCCACTGAAAGTC -3'
(R):5'- ACTGTTCTTCTCAGATAAAGGGAC -3'

Sequencing Primer
(F):5'- ATCATTTCTTTGAAGCTTGTGACTC -3'
(R):5'- GACTTCCATTCTGGGTTCTGAAAGAC -3'
Posted On2014-08-25