Incidental Mutation 'R2021:Tnr'
ID223922
Institutional Source Beutler Lab
Gene Symbol Tnr
Ensembl Gene ENSMUSG00000015829
Gene Nametenascin R
SynonymsTN-R, janusin, restrictin, J1-tenascin
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location159523769-159931729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 159852022 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 189 (I189V)
Ref Sequence ENSEMBL: ENSMUSP00000141553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069] [ENSMUST00000193325]
Predicted Effect probably benign
Transcript: ENSMUST00000111669
AA Change: I189V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: I189V

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192069
AA Change: I189V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: I189V

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192457
Predicted Effect probably benign
Transcript: ENSMUST00000193325
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Tnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tnr APN 1 159861245 missense probably benign 0.00
IGL00905:Tnr APN 1 159852182 missense probably benign 0.06
IGL01396:Tnr APN 1 159897024 missense possibly damaging 0.91
IGL01550:Tnr APN 1 159874258 missense probably benign
IGL01803:Tnr APN 1 159868243 missense probably damaging 1.00
IGL01845:Tnr APN 1 159868006 unclassified probably benign
IGL01983:Tnr APN 1 159863779 missense probably benign 0.00
IGL01985:Tnr APN 1 159919037 missense possibly damaging 0.70
IGL02210:Tnr APN 1 159852101 missense probably benign 0.44
IGL02486:Tnr APN 1 159852094 unclassified probably null
IGL03210:Tnr APN 1 159888310 missense probably benign 0.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0009:Tnr UTSW 1 159852416 missense probably damaging 1.00
R0042:Tnr UTSW 1 159887025 missense probably benign 0.01
R0594:Tnr UTSW 1 159850335 missense probably benign
R0617:Tnr UTSW 1 159868103 missense probably damaging 1.00
R0637:Tnr UTSW 1 159850335 missense possibly damaging 0.60
R0682:Tnr UTSW 1 159852307 nonsense probably null
R1171:Tnr UTSW 1 159858210 missense probably damaging 0.97
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1335:Tnr UTSW 1 159868030 missense probably benign 0.18
R1540:Tnr UTSW 1 159850105 missense probably damaging 0.99
R1697:Tnr UTSW 1 159852030 missense probably benign 0.00
R1938:Tnr UTSW 1 159895037 nonsense probably null
R1941:Tnr UTSW 1 159850134 missense possibly damaging 0.92
R2022:Tnr UTSW 1 159852022 missense probably benign
R2051:Tnr UTSW 1 159892033 missense probably benign
R2157:Tnr UTSW 1 159858270 missense probably damaging 0.98
R2319:Tnr UTSW 1 159850048 start codon destroyed probably null 1.00
R2936:Tnr UTSW 1 159888362 missense probably damaging 0.96
R3015:Tnr UTSW 1 159888259 missense probably benign 0.00
R3417:Tnr UTSW 1 159895042 missense probably benign 0.00
R3739:Tnr UTSW 1 159923413 missense possibly damaging 0.78
R3977:Tnr UTSW 1 159892023 missense probably benign
R4232:Tnr UTSW 1 159886215 missense possibly damaging 0.55
R4478:Tnr UTSW 1 159884756 splice site probably null
R4774:Tnr UTSW 1 159897066 missense probably damaging 1.00
R4829:Tnr UTSW 1 159858404 missense probably benign 0.24
R4837:Tnr UTSW 1 159684788 intron probably benign
R5111:Tnr UTSW 1 159886228 missense probably benign 0.04
R5224:Tnr UTSW 1 159923315 missense probably damaging 1.00
R5249:Tnr UTSW 1 159684656 intron probably benign
R5730:Tnr UTSW 1 159888322 missense probably benign 0.02
R5807:Tnr UTSW 1 159886930 missense possibly damaging 0.95
R5832:Tnr UTSW 1 159886122 missense probably benign 0.15
R5927:Tnr UTSW 1 159912766 missense probably damaging 1.00
R6049:Tnr UTSW 1 159912754 missense probably damaging 1.00
R6056:Tnr UTSW 1 159886909 missense probably damaging 0.99
R6063:Tnr UTSW 1 159912684 missense probably benign 0.00
R6141:Tnr UTSW 1 159887122 missense probably benign
R6218:Tnr UTSW 1 159888314 missense possibly damaging 0.94
R6275:Tnr UTSW 1 159861270 missense probably damaging 0.99
R6543:Tnr UTSW 1 159924107 missense probably damaging 1.00
R6626:Tnr UTSW 1 159850252 missense probably damaging 1.00
X0011:Tnr UTSW 1 159889338 missense probably benign 0.02
X0028:Tnr UTSW 1 159874114 missense probably damaging 1.00
Z1088:Tnr UTSW 1 159895095 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTGCAGTGGGTGAAAATGTG -3'
(R):5'- TGTAGGGCTCTTCACAGACAC -3'

Sequencing Primer
(F):5'- TGTAGTTAACTCTCAGCAGCAC -3'
(R):5'- TAGGGCTCTTCACAGACACATTCC -3'
Posted On2014-08-25