Incidental Mutation 'R2144:Ralgapa2'
ID236585
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 040147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R2144 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146388604 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1014 (V1014L)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect probably damaging
Transcript: ENSMUST00000109986
AA Change: V967L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: V967L

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131824
AA Change: V929L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: V929L

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146307
SMART Domains Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 285 290 N/A INTRINSIC
Pfam:Rap_GAP 690 830 4.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148784
Predicted Effect unknown
Transcript: ENSMUST00000149499
AA Change: V599L
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: V599L

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228797
AA Change: V1014L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Acsl6 A T 11: 54,341,778 Q485L probably damaging Het
Adam5 C A 8: 24,815,480 V81F probably benign Het
Armc4 C T 18: 7,127,229 E995K probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cap2 A T 13: 46,560,502 probably null Het
Ccnk T A 12: 108,189,090 L102Q probably null Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdc123 A T 2: 5,810,806 I160K probably benign Het
Cep85l T C 10: 53,358,126 N52S probably benign Het
Cntnap5a C T 1: 116,101,710 T298I probably benign Het
Cpsf4 G T 5: 145,178,762 S192I probably benign Het
Cpxm1 A G 2: 130,397,410 S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 F137S probably damaging Het
Des A G 1: 75,366,804 T444A probably benign Het
Dgcr8 C T 16: 18,284,256 G54D probably damaging Het
Doxl2 A G 6: 48,975,291 H50R probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Ep400 A T 5: 110,703,518 M1366K unknown Het
Epg5 G T 18: 77,954,197 C425F possibly damaging Het
Epha3 C G 16: 63,773,317 R136P possibly damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fam186b A G 15: 99,280,657 Y263H probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Gart A T 16: 91,630,081 I555N probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gnptab C T 10: 88,428,506 S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 V263A probably benign Het
Gxylt1 T C 15: 93,254,480 I224V probably benign Het
H2-Aa A G 17: 34,283,827 S122P probably damaging Het
Hsph1 A C 5: 149,630,337 probably null Het
Hunk G A 16: 90,432,532 D94N probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Ints10 A G 8: 68,796,805 T96A probably damaging Het
Kansl2 A T 15: 98,526,631 V306E probably benign Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Ktn1 A G 14: 47,714,652 E983G probably damaging Het
Lrrk1 G A 7: 66,296,163 S566L probably damaging Het
M6pr A G 6: 122,315,367 M174V probably benign Het
Man2a2 A G 7: 80,363,516 S510P probably damaging Het
Mmrn1 G A 6: 60,945,075 S172N possibly damaging Het
Mpv17 A G 5: 31,154,189 probably null Het
Mrgpra9 T C 7: 47,235,463 E152G probably benign Het
Mst1r T C 9: 107,913,168 V660A probably benign Het
Myof A G 19: 37,981,221 probably null Het
Myrf G A 19: 10,228,674 P126L probably benign Het
Nckap1l C T 15: 103,475,676 A567V probably damaging Het
Nphs1 A G 7: 30,460,970 E169G probably benign Het
Npy1r T A 8: 66,705,184 V382D probably benign Het
Nrl A T 14: 55,520,850 M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 I144T probably damaging Het
Olfr199 C T 16: 59,216,026 V196M probably benign Het
Olfr292 T A 7: 86,695,280 F275I probably damaging Het
Olfr694 A T 7: 106,688,957 M258K probably damaging Het
Olfr924 C T 9: 38,848,339 T75I probably damaging Het
Orc5 T A 5: 22,547,927 L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 S396T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pclo C T 5: 14,858,752 L5025F unknown Het
Pde3a T C 6: 141,490,111 V924A probably benign Het
Pdpr A G 8: 111,118,036 N355S probably damaging Het
Pepd A T 7: 34,921,418 K36M probably benign Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pik3r6 T A 11: 68,543,611 L546* probably null Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Primpol A T 8: 46,586,343 M414K probably damaging Het
Prol1 A T 5: 88,328,395 T215S unknown Het
Prss22 A G 17: 23,994,682 Y212H probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rbm26 T A 14: 105,115,202 R1009* probably null Het
Rbm42 A G 7: 30,641,110 *450Q probably null Het
Rere T C 4: 150,616,931 V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 L15F probably damaging Het
Rnf213 T C 11: 119,443,690 S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Sin3b T C 8: 72,731,265 L203P probably damaging Het
Skint6 T C 4: 113,236,260 S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 Y566C probably damaging Het
Smgc T G 15: 91,844,421 D121E possibly damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
St7 A T 6: 17,886,007 N52I possibly damaging Het
Sycn C A 7: 28,541,069 Q54K probably benign Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 V23G possibly damaging Het
Trhr T C 15: 44,197,183 V33A probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Trnt1 A G 6: 106,778,039 K244E probably damaging Het
Tsfm G A 10: 127,028,445 Q134* probably null Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 L623F probably damaging Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 T959A probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGACTAAATGAAATAACTCTCAGGC -3'
(R):5'- AATCTTCACATGATCACCCCATTG -3'

Sequencing Primer
(F):5'- CGTCTAATTTGCATTTCAGAAATGG -3'
(R):5'- CTTGTTGGGCATTCAATTTGAAAG -3'
Posted On2014-10-01