Incidental Mutation 'R0305:Kpna6'
ID24889
Institutional Source Beutler Lab
Gene Symbol Kpna6
Ensembl Gene ENSMUSG00000003731
Gene Namekaryopherin (importin) alpha 6
SynonymsIPOA7, NPI-2
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129643980-129672767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129649249 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 458 (R458S)
Ref Sequence ENSEMBL: ENSMUSP00000099650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590]
Predicted Effect probably benign
Transcript: ENSMUST00000003828
AA Change: R455S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731
AA Change: R455S

DomainStartEndE-ValueType
Pfam:IBB 2 100 9.5e-28 PFAM
ARM 109 151 2.46e-4 SMART
ARM 153 193 6.73e-11 SMART
ARM 195 236 3.19e-3 SMART
ARM 239 278 6.64e-1 SMART
ARM 280 320 1.16e-5 SMART
ARM 322 362 1.98e-8 SMART
ARM 364 404 6.68e-6 SMART
ARM 407 447 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102590
AA Change: R458S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731
AA Change: R458S

DomainStartEndE-ValueType
Pfam:IBB 9 102 4.4e-27 PFAM
ARM 112 154 2.46e-4 SMART
ARM 156 196 6.73e-11 SMART
ARM 198 239 3.19e-3 SMART
ARM 242 281 6.64e-1 SMART
ARM 283 323 1.16e-5 SMART
ARM 325 365 1.98e-8 SMART
ARM 367 407 6.68e-6 SMART
ARM 410 450 1.89e-5 SMART
Pfam:Arm_3 464 514 5.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138916
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Kpna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Kpna6 APN 4 129655483 missense probably damaging 1.00
IGL02750:Kpna6 APN 4 129661377 missense probably damaging 1.00
IGL02904:Kpna6 APN 4 129650687 missense probably benign 0.24
IGL02998:Kpna6 APN 4 129655504 missense probably benign 0.00
IGL03370:Kpna6 APN 4 129655521 missense probably damaging 1.00
krazy_eight UTSW 4 129655428 critical splice donor site probably null
magnificent_seven UTSW 4 129649306 nonsense probably null
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0390:Kpna6 UTSW 4 129657804 missense possibly damaging 0.61
R0623:Kpna6 UTSW 4 129655416 unclassified probably benign
R0646:Kpna6 UTSW 4 129650790 missense probably benign 0.43
R1067:Kpna6 UTSW 4 129648103 missense probably benign 0.39
R1348:Kpna6 UTSW 4 129661359 nonsense probably null
R1661:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1665:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1766:Kpna6 UTSW 4 129657442 missense probably benign 0.33
R4833:Kpna6 UTSW 4 129657779 missense possibly damaging 0.51
R4941:Kpna6 UTSW 4 129648032 missense probably damaging 1.00
R4974:Kpna6 UTSW 4 129656405 splice site probably null
R5244:Kpna6 UTSW 4 129655428 critical splice donor site probably null
R5914:Kpna6 UTSW 4 129672692 unclassified probably benign
R6148:Kpna6 UTSW 4 129649306 nonsense probably null
R6713:Kpna6 UTSW 4 129653984 missense probably damaging 1.00
R6799:Kpna6 UTSW 4 129657454 missense probably damaging 0.99
R6942:Kpna6 UTSW 4 129651721 splice site probably null
R7073:Kpna6 UTSW 4 129654346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAACCCTGTGCTTGGACTAGC -3'
(R):5'- TGTAGCCAAGGGGACAATAGGACTC -3'

Sequencing Primer
(F):5'- cctctgaccttcatcccac -3'
(R):5'- CAATAGGACTCCGTGTTCATTAGG -3'
Posted On2013-04-16