Incidental Mutation 'R0317:Olfr948'
ID25465
Institutional Source Beutler Lab
Gene Symbol Olfr948
Ensembl Gene ENSMUSG00000057349
Gene Nameolfactory receptor 948
SynonymsMOR171-45, GA_x6K02T2PVTD-33016899-33015934, MOR171-51
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39315712-39326045 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39319461 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 51 (I51T)
Ref Sequence ENSEMBL: ENSMUSP00000149422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076516] [ENSMUST00000216132]
Predicted Effect probably benign
Transcript: ENSMUST00000076516
AA Change: I51T

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075834
Gene: ENSMUSG00000057349
AA Change: I51T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216132
AA Change: I51T

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Olfr948
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Olfr948 APN 9 39318832 nonsense probably null
IGL02297:Olfr948 APN 9 39318703 missense possibly damaging 0.64
IGL02678:Olfr948 APN 9 39318921 missense probably benign 0.01
IGL03182:Olfr948 APN 9 39318981 missense probably benign 0.16
R0116:Olfr948 UTSW 9 39318864 missense probably damaging 1.00
R0152:Olfr948 UTSW 9 39319461 missense probably benign 0.32
R0227:Olfr948 UTSW 9 39318678 missense probably benign 0.00
R2151:Olfr948 UTSW 9 39319117 missense probably damaging 0.97
R2210:Olfr948 UTSW 9 39318793 missense probably damaging 1.00
R2974:Olfr948 UTSW 9 39318996 missense probably damaging 1.00
R4716:Olfr948 UTSW 9 39319429 missense probably benign 0.22
R4886:Olfr948 UTSW 9 39319585 missense probably benign 0.01
R5058:Olfr948 UTSW 9 39318664 missense probably benign
R5339:Olfr948 UTSW 9 39319303 missense possibly damaging 0.94
R6431:Olfr948 UTSW 9 39318778 missense possibly damaging 0.50
R6736:Olfr948 UTSW 9 39318793 missense probably damaging 1.00
R6902:Olfr948 UTSW 9 39319019 missense probably damaging 1.00
R6946:Olfr948 UTSW 9 39319019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGAACCATGCATCCAGAGTAG -3'
(R):5'- TGCACCACAGTGGGACACTTTTC -3'

Sequencing Primer
(F):5'- AGGAGATGATGTTCTTCTTTGTCAG -3'
(R):5'- GTGACTCTAACAGGCTTACAACTG -3'
Posted On2013-04-16