Incidental Mutation 'R1614:Gm6741'
ID254705
Institutional Source Beutler Lab
Gene Symbol Gm6741
Ensembl Gene ENSMUSG00000043346
Gene Namepredicted gene 6741
Synonyms
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R1614 (G1)
Quality Score26
Status Validated
Chromosome17
Chromosomal Location91236787-91238116 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91236996 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 62 (H62Q)
Ref Sequence ENSEMBL: ENSMUSP00000094869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057074]
PDB Structure
Crystal structure of a n-acetylneuraminic acid phosphatase (nanp) from mus musculus at 1.90 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057074
AA Change: H62Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000094869
Gene: ENSMUSG00000043346
AA Change: H62Q

DomainStartEndE-ValueType
Pfam:Hydrolase 6 202 1.3e-16 PFAM
Pfam:HAD_2 9 208 8.2e-22 PFAM
Pfam:Hydrolase_like 162 233 1.5e-11 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Gm6741
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4504001:Gm6741 UTSW 17 91236916 nonsense probably null
R2024:Gm6741 UTSW 17 91236881 missense probably benign 0.00
R2174:Gm6741 UTSW 17 91236904 missense probably benign
R5928:Gm6741 UTSW 17 91237100 missense probably damaging 1.00
R6867:Gm6741 UTSW 17 91236911 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGACCTGGACAACACACTCATCG -3'
(R):5'- GTTCTCCGCCAATAACAATGGCATC -3'

Sequencing Primer
(F):5'- ACACTCATCGACACGGC -3'
(R):5'- AGCAGGCGGACCTCTTTTC -3'
Posted On2014-12-17