Incidental Mutation 'R3011:Dnajc5b'
ID257500
Institutional Source Beutler Lab
Gene Symbol Dnajc5b
Ensembl Gene ENSMUSG00000027606
Gene NameDnaJ heat shock protein family (Hsp40) member C5 beta
Synonyms
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19508595-19610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19546802 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 21 (Y21F)
Ref Sequence ENSEMBL: ENSMUSP00000127515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029132] [ENSMUST00000118735] [ENSMUST00000118968] [ENSMUST00000165693]
Predicted Effect probably damaging
Transcript: ENSMUST00000029132
AA Change: Y21F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029132
Gene: ENSMUSG00000027606
AA Change: Y21F

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118735
AA Change: Y21F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113414
Gene: ENSMUSG00000027606
AA Change: Y21F

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118968
AA Change: Y21F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112849
Gene: ENSMUSG00000027606
AA Change: Y21F

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165693
AA Change: Y21F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127515
Gene: ENSMUSG00000027606
AA Change: Y21F

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of co-chaperone proteins that is characterized by an N-terminal DNAJ domain, a linker region, and a cysteine-rich C-terminal domain. The encoded protein, together with heat shock protein 70, is thought to regulate the proper folding of other proteins. The orthologous mouse protein is membrane-associated and is targeted to the trans-golgi network. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Dnajc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1630:Dnajc5b UTSW 3 19574741 missense probably damaging 1.00
R1714:Dnajc5b UTSW 3 19579101 nonsense probably null
R3859:Dnajc5b UTSW 3 19574802 nonsense probably null
R5268:Dnajc5b UTSW 3 19579060 missense probably benign 0.00
R5281:Dnajc5b UTSW 3 19610560 missense probably benign 0.37
R5337:Dnajc5b UTSW 3 19574782 missense probably damaging 1.00
R5929:Dnajc5b UTSW 3 19546855 missense probably damaging 1.00
R7081:Dnajc5b UTSW 3 19546861 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAAAGCACTTTTAGCTCTTGG -3'
(R):5'- AATCAGATCACCTGGTCTTGG -3'

Sequencing Primer
(F):5'- CAAATGCTGGTCTTTTTAAACAGGTG -3'
(R):5'- ATCACCTGGTCTTGGTAAGAAGC -3'
Posted On2015-01-11