Incidental Mutation 'R3011:Srgap2'
ID257493
Institutional Source Beutler Lab
Gene Symbol Srgap2
Ensembl Gene ENSMUSG00000026425
Gene NameSLIT-ROBO Rho GTPase activating protein 2
SynonymsFBP2, Fnbp2, 9930124L22Rik
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131285251-131527352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131310591 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 520 (Q520L)
Ref Sequence ENSEMBL: ENSMUSP00000141140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000185596] [ENSMUST00000186543]
Predicted Effect probably damaging
Transcript: ENSMUST00000097588
AA Change: Q661L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425
AA Change: Q661L

DomainStartEndE-ValueType
FCH 22 120 7.33e-18 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 9.6e-60 SMART
SH3 731 786 4.52e-15 SMART
low complexity region 852 868 N/A INTRINSIC
coiled coil region 940 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185596
AA Change: Q520L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141140
Gene: ENSMUSG00000026425
AA Change: Q520L

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
coiled coil region 222 260 N/A INTRINSIC
Blast:RhoGAP 304 349 5e-12 BLAST
RhoGAP 361 535 5.9e-62 SMART
SH3 590 645 2.8e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186543
AA Change: Q661L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425
AA Change: Q661L

DomainStartEndE-ValueType
FCH 22 120 3.7e-20 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 5.9e-62 SMART
SH3 731 786 2.8e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000188770
AA Change: Q275L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190336
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Srgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Srgap2 APN 1 131356700 missense possibly damaging 0.89
IGL01738:Srgap2 APN 1 131296426 missense probably benign 0.00
IGL01933:Srgap2 APN 1 131411855 missense probably damaging 1.00
IGL01964:Srgap2 APN 1 131289578 missense probably benign 0.08
IGL02028:Srgap2 APN 1 131296435 missense probably damaging 0.98
IGL02159:Srgap2 APN 1 131319666 splice site probably benign
IGL02326:Srgap2 APN 1 131356907 critical splice acceptor site probably null
IGL02396:Srgap2 APN 1 131292675 missense probably damaging 0.99
IGL02407:Srgap2 APN 1 131319602 missense probably damaging 1.00
IGL02444:Srgap2 APN 1 131325153 splice site probably null
IGL02559:Srgap2 APN 1 131524936 critical splice donor site probably null
IGL02900:Srgap2 APN 1 131411796 splice site probably benign
IGL03150:Srgap2 APN 1 131310600 missense probably damaging 1.00
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0044:Srgap2 UTSW 1 131319551 missense possibly damaging 0.68
R0441:Srgap2 UTSW 1 131336437 missense probably damaging 1.00
R0580:Srgap2 UTSW 1 131349501 missense possibly damaging 0.81
R0882:Srgap2 UTSW 1 131289515 missense probably benign 0.00
R1412:Srgap2 UTSW 1 131300413 missense possibly damaging 0.81
R1501:Srgap2 UTSW 1 131292699 missense probably damaging 1.00
R1740:Srgap2 UTSW 1 131289388 missense probably benign 0.00
R1764:Srgap2 UTSW 1 131319537 missense possibly damaging 0.94
R1772:Srgap2 UTSW 1 131319638 missense probably damaging 0.99
R1776:Srgap2 UTSW 1 131411850 missense probably damaging 1.00
R2393:Srgap2 UTSW 1 131332134 missense probably benign 0.00
R3149:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3150:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3800:Srgap2 UTSW 1 131310559 missense probably damaging 1.00
R4871:Srgap2 UTSW 1 131289472 missense probably benign 0.00
R4884:Srgap2 UTSW 1 131292576 unclassified probably null
R5454:Srgap2 UTSW 1 131289737 missense probably benign 0.08
R5536:Srgap2 UTSW 1 131300390 splice site probably null
R6113:Srgap2 UTSW 1 131355505 splice site probably null
R6174:Srgap2 UTSW 1 131289616 missense probably benign 0.00
R6180:Srgap2 UTSW 1 131349541 missense probably benign 0.00
R6341:Srgap2 UTSW 1 131291629 missense probably benign 0.02
R6357:Srgap2 UTSW 1 131355542 missense probably damaging 1.00
R6363:Srgap2 UTSW 1 131298468 missense probably damaging 1.00
R6770:Srgap2 UTSW 1 131298510 missense probably benign 0.00
R6934:Srgap2 UTSW 1 131317231 missense possibly damaging 0.81
R7007:Srgap2 UTSW 1 131319537 missense probably benign 0.15
R7077:Srgap2 UTSW 1 131344449 missense
R7147:Srgap2 UTSW 1 131310594 missense
R7326:Srgap2 UTSW 1 131291613 nonsense probably null
R7467:Srgap2 UTSW 1 131292667 missense probably damaging 0.97
X0022:Srgap2 UTSW 1 131411949 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAGTGATTATCAGGCACTC -3'
(R):5'- TTTCCAGAAGGCCTCAGATGC -3'

Sequencing Primer
(F):5'- AGCAGTGATTATCAGGCACTCTTTTC -3'
(R):5'- GGCCTCAGATGCCCAGAAAG -3'
Posted On2015-01-11