Incidental Mutation 'R3011:Tex11'
ID257523
Institutional Source Beutler Lab
Gene Symbol Tex11
Ensembl Gene ENSMUSG00000009670
Gene Nametestis expressed gene 11
Synonyms4930565P14Rik
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R3011 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location100838648-101059667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100933415 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 487 (A487S)
Ref Sequence ENSEMBL: ENSMUSP00000109347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009814] [ENSMUST00000113716] [ENSMUST00000113718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009814
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009814
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 176 431 1.1e-62 PFAM
low complexity region 702 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113716
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109345
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113718
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109347
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 3.8e-70 PFAM
low complexity region 702 713 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Miche homozygous for a knockout allele exhibit abnormal male meiosis. Mice homozygous for a conditional knockout exhibit male infertility and reduced female fecundity due to abnormal meiosis following cre recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Tex11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Tex11 APN X 101032559 missense probably null 0.00
IGL00838:Tex11 APN X 100972118 missense possibly damaging 0.92
IGL02385:Tex11 APN X 100876529 splice site probably benign
R2958:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2960:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2963:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3008:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3009:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3010:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3745:Tex11 UTSW X 100916572 missense probably benign 0.33
R3881:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3882:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4081:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4082:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4159:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4172:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4197:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4201:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4204:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4206:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4304:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4305:Tex11 UTSW X 100933415 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ATGATGGTTTCCCGAATTCTTG -3'
(R):5'- GAGTACTCCTCAACAATTGTGTC -3'

Sequencing Primer
(F):5'- CTTGTCCAATATTTGCCCATTTAAG -3'
(R):5'- GCCATAGCAGAAGTTGAG -3'
Posted On2015-01-11