Incidental Mutation 'R2884:Stau2'
ID260945
Institutional Source Beutler Lab
Gene Symbol Stau2
Ensembl Gene ENSMUSG00000025920
Gene Namestaufen double-stranded RNA binding protein 2
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location16228674-16520112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16231066 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 519 (F519Y)
Ref Sequence ENSEMBL: ENSMUSP00000124505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027052] [ENSMUST00000054668] [ENSMUST00000162435] [ENSMUST00000162627] [ENSMUST00000162751]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027052
AA Change: F487Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027052
Gene: ENSMUSG00000025920
AA Change: F487Y

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000054668
AA Change: F519Y

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053190
Gene: ENSMUSG00000025920
AA Change: F519Y

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 6e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000162435
AA Change: F487Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123827
Gene: ENSMUSG00000025920
AA Change: F487Y

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000162627
AA Change: F487Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123781
Gene: ENSMUSG00000025920
AA Change: F487Y

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000162751
AA Change: F519Y

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124505
Gene: ENSMUSG00000025920
AA Change: F519Y

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
Pfam:Staufen_C 455 523 6.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186343
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Stau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Stau2 APN 1 16345698 makesense probably null
IGL01809:Stau2 APN 1 16440315 splice site probably null
IGL01895:Stau2 APN 1 16345937 missense probably damaging 0.99
IGL02164:Stau2 APN 1 16345828 missense probably damaging 1.00
IGL02507:Stau2 APN 1 16486069 missense possibly damaging 0.93
R0124:Stau2 UTSW 1 16463128 missense probably damaging 1.00
R0595:Stau2 UTSW 1 16440450 missense probably damaging 1.00
R1104:Stau2 UTSW 1 16440361 nonsense probably null
R1296:Stau2 UTSW 1 16440372 missense probably benign
R1359:Stau2 UTSW 1 16392566 missense probably damaging 1.00
R4066:Stau2 UTSW 1 16394059 missense possibly damaging 0.83
R4718:Stau2 UTSW 1 16346045 intron probably null
R5496:Stau2 UTSW 1 16390021 missense probably damaging 1.00
R6232:Stau2 UTSW 1 16374811 missense probably benign 0.00
R6447:Stau2 UTSW 1 16389825 missense possibly damaging 0.92
R6964:Stau2 UTSW 1 16390005 missense probably damaging 1.00
R7317:Stau2 UTSW 1 16460329 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCCCTCAATGGCCAACTC -3'
(R):5'- GCCAGAGCTCAGAGTAATGG -3'

Sequencing Primer
(F):5'- TGGCCAACTCACAGCTTAG -3'
(R):5'- TGGAACACACACACTATCATGC -3'
Posted On2015-01-23