Incidental Mutation 'R3155:Cdhr3'
ID263472
Institutional Source Beutler Lab
Gene Symbol Cdhr3
Ensembl Gene ENSMUSG00000035860
Gene Namecadherin-related family member 3
Synonyms1110049B09Rik
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location33033796-33092875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33049153 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 480 (I480F)
Ref Sequence ENSEMBL: ENSMUSP00000093449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095774
AA Change: I480F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093449
Gene: ENSMUSG00000035860
AA Change: I480F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 36 131 5.54e-2 SMART
CA 156 234 3.73e-10 SMART
CA 258 343 5.47e-17 SMART
CA 369 459 9.87e-1 SMART
CA 483 564 1.17e-16 SMART
CA 590 683 1.1e0 SMART
transmembrane domain 708 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219453
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Cdhr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Cdhr3 APN 12 33052209 missense probably benign 0.00
IGL01508:Cdhr3 APN 12 33053428 missense possibly damaging 0.84
IGL02396:Cdhr3 APN 12 33045196 missense possibly damaging 0.64
IGL02414:Cdhr3 APN 12 33042504 missense possibly damaging 0.76
IGL02450:Cdhr3 APN 12 33082225 missense probably benign
IGL02453:Cdhr3 APN 12 33042503 missense probably damaging 0.97
IGL02567:Cdhr3 APN 12 33038901 missense probably benign 0.02
IGL03342:Cdhr3 APN 12 33051055 missense probably benign 0.14
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0133:Cdhr3 UTSW 12 33092752 missense possibly damaging 0.94
R0140:Cdhr3 UTSW 12 33080413 missense probably benign 0.00
R0157:Cdhr3 UTSW 12 33061650 missense possibly damaging 0.52
R0762:Cdhr3 UTSW 12 33060301 missense probably benign 0.01
R1421:Cdhr3 UTSW 12 33060292 missense probably damaging 1.00
R1553:Cdhr3 UTSW 12 33042371 missense probably benign 0.10
R1691:Cdhr3 UTSW 12 33082247 missense probably damaging 0.99
R1822:Cdhr3 UTSW 12 33045205 missense probably null 1.00
R1855:Cdhr3 UTSW 12 33060352 missense probably damaging 1.00
R1897:Cdhr3 UTSW 12 33045193 missense possibly damaging 0.81
R2496:Cdhr3 UTSW 12 33049069 missense probably benign 0.01
R2507:Cdhr3 UTSW 12 33038915 missense probably benign
R3906:Cdhr3 UTSW 12 33053428 missense probably damaging 0.97
R4005:Cdhr3 UTSW 12 33080356 missense probably damaging 0.98
R4277:Cdhr3 UTSW 12 33060233 missense probably null 0.16
R4573:Cdhr3 UTSW 12 33068153 splice site probably null
R4752:Cdhr3 UTSW 12 33086103 missense probably damaging 0.99
R5364:Cdhr3 UTSW 12 33051008 missense possibly damaging 0.67
R5562:Cdhr3 UTSW 12 33051055 missense probably benign 0.01
R5564:Cdhr3 UTSW 12 33048986 nonsense probably null
R5768:Cdhr3 UTSW 12 33046686 missense possibly damaging 0.73
R6255:Cdhr3 UTSW 12 33053475 missense probably damaging 1.00
R6821:Cdhr3 UTSW 12 33035045 missense probably damaging 1.00
R6983:Cdhr3 UTSW 12 33042380 missense probably benign 0.32
R7155:Cdhr3 UTSW 12 33061773 missense probably damaging 1.00
R7496:Cdhr3 UTSW 12 33060265 missense probably damaging 1.00
X0024:Cdhr3 UTSW 12 33067236 missense possibly damaging 0.90
X0028:Cdhr3 UTSW 12 33042456 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTGACTGAGCTCCTGTC -3'
(R):5'- CAGTGCTACTGTTAAAGGTTGG -3'

Sequencing Primer
(F):5'- CCTCGACGGTGAGAATGTAGAC -3'
(R):5'- AGTGCTACTGTTAAAGGTTGGGAGTG -3'
Posted On2015-02-05