Incidental Mutation 'R3434:Tle3'
ID266352
Institutional Source Beutler Lab
Gene Symbol Tle3
Ensembl Gene ENSMUSG00000032280
Gene Nametransducin-like enhancer of split 3
Synonyms2610103N05Rik, ESG, Grg3a, Grg3b
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3434 (G1)
Quality Score201
Status Validated
Chromosome9
Chromosomal Location61372366-61418497 bp(+) (GRCm38)
Type of Mutationunclassified (4729 bp from exon)
DNA Base Change (assembly) T to A at 61414094 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034820] [ENSMUST00000159050] [ENSMUST00000159386] [ENSMUST00000159630] [ENSMUST00000160882] [ENSMUST00000161207] [ENSMUST00000161689] [ENSMUST00000161993] [ENSMUST00000162127] [ENSMUST00000162583] [ENSMUST00000162973] [ENSMUST00000178113]
Predicted Effect probably benign
Transcript: ENSMUST00000034820
SMART Domains Protein: ENSMUSP00000034820
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 4.3e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 468 505 2.96e-2 SMART
WD40 511 552 4.48e-2 SMART
WD40 557 596 2.84e-4 SMART
WD40 599 638 7.55e-9 SMART
WD40 641 679 3.07e1 SMART
WD40 681 720 4.18e-2 SMART
WD40 721 761 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159050
SMART Domains Protein: ENSMUSP00000125032
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 471 508 2.96e-2 SMART
WD40 514 555 4.48e-2 SMART
WD40 560 599 2.84e-4 SMART
WD40 602 641 7.55e-9 SMART
WD40 644 682 3.07e1 SMART
WD40 684 723 4.18e-2 SMART
WD40 724 764 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159140
Predicted Effect probably benign
Transcript: ENSMUST00000159386
SMART Domains Protein: ENSMUSP00000125049
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 464 501 2.96e-2 SMART
WD40 507 548 4.48e-2 SMART
WD40 553 592 2.84e-4 SMART
WD40 595 634 7.55e-9 SMART
WD40 637 675 3.07e1 SMART
WD40 677 716 4.18e-2 SMART
WD40 717 757 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159630
SMART Domains Protein: ENSMUSP00000123723
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 79 1.7e-43 PFAM
low complexity region 104 122 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
low complexity region 226 245 N/A INTRINSIC
WD40 416 453 2.96e-2 SMART
WD40 459 500 4.48e-2 SMART
WD40 505 544 2.84e-4 SMART
WD40 547 586 7.55e-9 SMART
WD40 589 627 3.07e1 SMART
WD40 629 668 4.18e-2 SMART
WD40 669 709 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160882
SMART Domains Protein: ENSMUSP00000124131
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 146 4.8e-76 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
low complexity region 293 312 N/A INTRINSIC
WD40 486 523 2.96e-2 SMART
WD40 529 570 4.48e-2 SMART
WD40 575 614 2.84e-4 SMART
WD40 617 656 7.55e-9 SMART
WD40 659 697 3.07e1 SMART
WD40 699 738 4.18e-2 SMART
WD40 739 779 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161207
SMART Domains Protein: ENSMUSP00000124557
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 129 1e-73 PFAM
low complexity region 154 172 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
WD40 466 503 2.96e-2 SMART
WD40 509 550 4.48e-2 SMART
WD40 555 594 2.84e-4 SMART
WD40 597 636 7.55e-9 SMART
WD40 639 677 3.07e1 SMART
WD40 679 718 4.18e-2 SMART
WD40 719 759 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161689
SMART Domains Protein: ENSMUSP00000125011
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 4.8e-44 PFAM
low complexity region 105 123 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 227 246 N/A INTRINSIC
WD40 420 457 2.96e-2 SMART
WD40 463 504 4.48e-2 SMART
WD40 509 548 2.84e-4 SMART
WD40 551 590 7.55e-9 SMART
WD40 593 631 3.07e1 SMART
WD40 633 672 4.18e-2 SMART
WD40 673 713 1.79e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161993
SMART Domains Protein: ENSMUSP00000124432
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 135 2e-77 PFAM
low complexity region 160 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162127
SMART Domains Protein: ENSMUSP00000124150
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 83 1.2e-37 PFAM
low complexity region 108 126 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
WD40 406 443 2.96e-2 SMART
WD40 449 490 4.48e-2 SMART
WD40 495 534 2.84e-4 SMART
WD40 537 576 7.55e-9 SMART
WD40 579 617 3.07e1 SMART
WD40 619 658 4.18e-2 SMART
WD40 659 699 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162281
Predicted Effect probably benign
Transcript: ENSMUST00000162583
SMART Domains Protein: ENSMUSP00000124977
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 473 510 2.96e-2 SMART
WD40 516 557 4.48e-2 SMART
WD40 562 601 2.84e-4 SMART
WD40 604 643 7.55e-9 SMART
WD40 646 684 3.07e1 SMART
WD40 686 725 4.18e-2 SMART
WD40 726 766 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162962
Predicted Effect probably benign
Transcript: ENSMUST00000162973
SMART Domains Protein: ENSMUSP00000124173
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 476 513 2.96e-2 SMART
WD40 519 560 4.48e-2 SMART
WD40 565 604 2.84e-4 SMART
WD40 607 646 7.55e-9 SMART
WD40 649 687 3.07e1 SMART
WD40 689 728 4.18e-2 SMART
WD40 729 769 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178113
SMART Domains Protein: ENSMUSP00000136010
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 6e-73 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 294 313 N/A INTRINSIC
WD40 487 524 2.96e-2 SMART
WD40 530 571 4.48e-2 SMART
WD40 576 615 2.84e-4 SMART
WD40 618 657 7.55e-9 SMART
WD40 660 698 3.07e1 SMART
WD40 700 739 4.18e-2 SMART
WD40 740 780 1.79e-1 SMART
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homzoygous for a gene trap allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Tle3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Tle3 APN 9 61408757 splice site probably benign
IGL00671:Tle3 APN 9 61412370 missense probably damaging 1.00
IGL01583:Tle3 APN 9 61410025 missense probably benign 0.00
IGL01684:Tle3 APN 9 61403446 intron probably benign
IGL02109:Tle3 APN 9 61413050 missense probably damaging 1.00
IGL02386:Tle3 APN 9 61394659 missense possibly damaging 0.88
IGL02517:Tle3 APN 9 61414781 missense probably damaging 1.00
IGL02930:Tle3 APN 9 61394699 missense possibly damaging 0.52
IGL03103:Tle3 APN 9 61393242 missense possibly damaging 0.46
R0391:Tle3 UTSW 9 61416661 missense probably damaging 1.00
R0395:Tle3 UTSW 9 61410071 missense probably damaging 0.99
R0621:Tle3 UTSW 9 61410105 nonsense probably null
R1836:Tle3 UTSW 9 61414023 missense probably damaging 1.00
R1921:Tle3 UTSW 9 61411340 critical splice donor site probably null
R1978:Tle3 UTSW 9 61394633 missense probably damaging 1.00
R4242:Tle3 UTSW 9 61407423 missense probably benign
R4587:Tle3 UTSW 9 61374013 missense probably damaging 0.99
R4811:Tle3 UTSW 9 61373997 unclassified probably benign
R4877:Tle3 UTSW 9 61373499 intron probably benign
R4913:Tle3 UTSW 9 61373993 missense probably damaging 1.00
R5387:Tle3 UTSW 9 61407489 intron probably null
R5745:Tle3 UTSW 9 61414851 missense probably damaging 1.00
R5752:Tle3 UTSW 9 61407471 missense probably damaging 1.00
R5917:Tle3 UTSW 9 61408908 missense probably benign 0.19
R6000:Tle3 UTSW 9 61374014 missense probably damaging 1.00
R6339:Tle3 UTSW 9 61401924 synonymous probably null
R7210:Tle3 UTSW 9 61412305 missense probably damaging 1.00
R7460:Tle3 UTSW 9 61413084 missense probably damaging 0.99
R7545:Tle3 UTSW 9 61394702 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATGATTGCAGTCTCTGGGGC -3'
(R):5'- GCAAGCTGTGGACTTAGAATG -3'

Sequencing Primer
(F):5'- AGTCTCTGGGGCTCACC -3'
(R):5'- CAAGCTGTGGACTTAGAATGAGTTG -3'
Posted On2015-02-18