Incidental Mutation 'R3439:Tfr2'
ID267313
Institutional Source Beutler Lab
Gene Symbol Tfr2
Ensembl Gene ENSMUSG00000029716
Gene Nametransferrin receptor 2
SynonymsTrfr2, Tfr2
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137569840-137587481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 137574651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 215 (V215F)
Ref Sequence ENSEMBL: ENSMUSP00000142478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031729] [ENSMUST00000196471] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031729
AA Change: V215F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716
AA Change: V215F

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196375
Predicted Effect probably benign
Transcript: ENSMUST00000196471
AA Change: V215F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716
AA Change: V215F

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197705
Predicted Effect probably benign
Transcript: ENSMUST00000198783
AA Change: V215F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716
AA Change: V215F

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198866
AA Change: V215F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716
AA Change: V215F

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199054
AA Change: V215F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716
AA Change: V215F

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200190
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein, which is a member of the transferrin receptor-like family. This protein mediates cellular uptake of transferrin-bound iron, and may be involved in iron metabolism, hepatocyte function and erythrocyte differentiation. Mutations in this gene have been associated with hereditary hemochromatosis type III. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutant mice exhibit iron homeostasis defects similar to those observed in human hemachromatosis. On a standard diet, mutant mice show periportal hepatic iron loading, splenic iron sparing, and elevated serum transferrin saturations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Tfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tfr2 APN 5 137574455 missense probably null
IGL00960:Tfr2 APN 5 137571692 missense probably benign 0.00
IGL01360:Tfr2 APN 5 137571691 missense probably benign
IGL02967:Tfr2 APN 5 137582819 nonsense probably null
IGL02996:Tfr2 APN 5 137583466 missense probably benign
IGL03278:Tfr2 APN 5 137571036 nonsense probably null
iron-man UTSW 5 137583153 splice site probably benign
R0114:Tfr2 UTSW 5 137577465 missense probably benign 0.00
R1384:Tfr2 UTSW 5 137586820 splice site probably benign
R1525:Tfr2 UTSW 5 137579030 missense probably benign 0.00
R1545:Tfr2 UTSW 5 137583299 missense probably benign 0.03
R1765:Tfr2 UTSW 5 137583445 missense probably damaging 0.98
R1908:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R1943:Tfr2 UTSW 5 137578921 missense probably benign
R4332:Tfr2 UTSW 5 137571734 missense probably damaging 1.00
R4626:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R4915:Tfr2 UTSW 5 137583411 missense probably damaging 0.96
R4999:Tfr2 UTSW 5 137586925 missense probably benign 0.00
R5150:Tfr2 UTSW 5 137574490 missense probably benign 0.22
R5200:Tfr2 UTSW 5 137570980 splice site probably benign
R5936:Tfr2 UTSW 5 137587006 missense probably benign 0.00
R6165:Tfr2 UTSW 5 137580257 missense probably damaging 0.97
R6513:Tfr2 UTSW 5 137574531 splice site probably null
X0067:Tfr2 UTSW 5 137577548 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGACTGACACGCACTAC -3'
(R):5'- GTAATTCCAACTCGCACTAGCAGG -3'

Sequencing Primer
(F):5'- GCACTACGTGGGACTTCAGTTC -3'
(R):5'- TAGTGGGCGTACACCAGCTTG -3'
Posted On2015-02-18