Incidental Mutation 'R3439:Helq'
ID267310
Institutional Source Beutler Lab
Gene Symbol Helq
Ensembl Gene ENSMUSG00000035266
Gene Namehelicase, POLQ-like
SynonymsD430018E21Rik, Hel308
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3439 (G1)
Quality Score139
Status Validated
Chromosome5
Chromosomal Location100762145-100798598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100798304 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 57 (E57G)
Ref Sequence ENSEMBL: ENSMUSP00000118493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016977] [ENSMUST00000044684] [ENSMUST00000112898] [ENSMUST00000112901] [ENSMUST00000151201] [ENSMUST00000198453]
Predicted Effect probably benign
Transcript: ENSMUST00000016977
SMART Domains Protein: ENSMUSP00000016977
Gene: ENSMUSG00000016833

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 70 121 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044684
AA Change: E57G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041599
Gene: ENSMUSG00000035266
AA Change: E57G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
DEXDc 291 486 3.05e-17 SMART
HELICc 585 671 2.54e-14 SMART
low complexity region 812 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112898
Predicted Effect probably benign
Transcript: ENSMUST00000112901
SMART Domains Protein: ENSMUSP00000108522
Gene: ENSMUSG00000016833

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 67 119 9.6e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133845
AA Change: E55G
SMART Domains Protein: ENSMUSP00000116470
Gene: ENSMUSG00000035266
AA Change: E55G

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
DEXDc 290 485 3.05e-17 SMART
HELICc 584 670 2.54e-14 SMART
low complexity region 811 826 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140296
Predicted Effect probably damaging
Transcript: ENSMUST00000151201
AA Change: E57G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118493
Gene: ENSMUSG00000035266
AA Change: E57G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197084
Predicted Effect probably benign
Transcript: ENSMUST00000198453
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase (Marini and Wood, 2002 [PubMed 11751861]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced fertility and increased incident of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Helq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Helq APN 5 100765082 unclassified probably benign
IGL02142:Helq APN 5 100783094 missense probably benign 0.01
IGL02172:Helq APN 5 100790147 missense probably damaging 1.00
IGL02234:Helq APN 5 100796470 missense possibly damaging 0.93
IGL03086:Helq APN 5 100796927 missense possibly damaging 0.60
R0083:Helq UTSW 5 100768368 nonsense probably null
R0108:Helq UTSW 5 100768368 nonsense probably null
R0276:Helq UTSW 5 100790147 missense probably damaging 1.00
R0359:Helq UTSW 5 100790200 missense probably benign 0.01
R0383:Helq UTSW 5 100779165 missense probably benign 0.28
R0554:Helq UTSW 5 100790200 missense probably benign 0.01
R1289:Helq UTSW 5 100796464 missense probably damaging 1.00
R1682:Helq UTSW 5 100792813 missense probably benign 0.41
R1800:Helq UTSW 5 100774124 missense probably benign 0.34
R1809:Helq UTSW 5 100773954 missense probably damaging 0.97
R1838:Helq UTSW 5 100771879 nonsense probably null
R3086:Helq UTSW 5 100773992 missense probably benign
R3735:Helq UTSW 5 100790188 missense possibly damaging 0.64
R3736:Helq UTSW 5 100790188 missense possibly damaging 0.64
R4172:Helq UTSW 5 100771847 missense probably benign 0.03
R4835:Helq UTSW 5 100774163 missense possibly damaging 0.82
R4855:Helq UTSW 5 100783159 missense possibly damaging 0.89
R4908:Helq UTSW 5 100762641 splice site probably null
R4973:Helq UTSW 5 100792871 intron probably benign
R5561:Helq UTSW 5 100787050 missense probably benign 0.06
R5583:Helq UTSW 5 100762593 missense probably damaging 0.99
R5608:Helq UTSW 5 100790219 missense probably damaging 1.00
R5682:Helq UTSW 5 100785304 missense probably benign 0.04
R5875:Helq UTSW 5 100796470 missense probably damaging 1.00
R6302:Helq UTSW 5 100798439 missense probably damaging 0.96
R6344:Helq UTSW 5 100766728 missense probably benign 0.27
R6446:Helq UTSW 5 100768384 missense possibly damaging 0.64
R6825:Helq UTSW 5 100792695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAAGCAGTGTCTCCCAAGTG -3'
(R):5'- TCACCTGCTGTCTCCAGAAC -3'

Sequencing Primer
(F):5'- TAACAAAGGTGAGAGAGCGAGCTAAG -3'
(R):5'- ACTCTGGGCCGTTGTCATG -3'
Posted On2015-02-18